Rmu_co8335391.1_g000001

DDB1- and CUL4-associated factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8335391.1
Physical Location & Seq
Reverse (-)
1 .. 563
563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8335391.1_g000001.1.cds

Sequence Viewer

Length: 242 bp
atggagctagatgtctcatctgacaagtctgttgagccgctagaaacttatgtttggaagaatgcatttcggtctgttgatcaccaatggaattttgatcgctttgccacaggtggagctggtgtagacatatggaaccacaacaggtctgcaccggaacagagtttggaatggggaacagacacagttatatctgtccggtttaatcctggacagcctgatcttttggcaacatccgcaag

Protein Analysis

80

Amino Acids

9.0

Weight (kDa)

4.54

Isoelectric Point (pI)

32.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 126
AciI CCGC 2 cut(s) 38, 237
AcsI RAATTY 1 cut(s) 91
AjnI CCWGG 1 cut(s) 208
AluBI AGCT 2 cut(s) 7, 119
AluI AGCT 2 cut(s) 7, 119
Alw26I GTCTC 1 cut(s) 19
ApoI RAATTY 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 210
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 19
BfaI CTAG 2 cut(s) 8, 41
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
Bme1390I CCNGG 1 cut(s) 210
BmiI GGNNCC 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 210
BsaWI WCCGGW 2 cut(s) 154, 198
BsaXI ACNNNNNCTCC 2 cut(s) 108, 138
BseBI CCWGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 233
BsgI GTGCAG 1 cut(s) 135
BsiSI CCGG 2 cut(s) 155, 199
BsmAI GTCTC 1 cut(s) 19
BsmI GAATGC 1 cut(s) 67
Bsp143I GATC 3 cut(s) 79, 97, 220
BspACI CCGC 2 cut(s) 38, 237
BspLI GGNNCC 1 cut(s) 137
BssMI GATC 3 cut(s) 79, 97, 220
Bst2UI CCWGG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 187
BstF5I GGATG 1 cut(s) 233
BstKTI GATC 3 cut(s) 82, 100, 223
BstMAI GTCTC 1 cut(s) 19
BstMBI GATC 3 cut(s) 79, 97, 220
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BtsCI GGATG 1 cut(s) 233
CviJI RGCY 4 cut(s) 7, 37, 119, 217
CviKI_1 RGCY 4 cut(s) 7, 37, 119, 217
DpnI GATC 3 cut(s) 81, 99, 222
DpnII GATC 3 cut(s) 79, 97, 220
EcoRII CCWGG 1 cut(s) 208
EcoT22I ATGCAT 1 cut(s) 67
FaiI YATR 4 cut(s) 51, 131, 133, 191
FauNDI CATATG 1 cut(s) 131
FbaI TGATCA 1 cut(s) 79
FblI GTMKAC 1 cut(s) 126
Fnu4HI GCNGC 1 cut(s) 38
FokI GGATG 1 cut(s) 220
Fsp4HI GCNGC 1 cut(s) 38
FspBI CTAG 2 cut(s) 8, 41
GluI GCNGC 1 cut(s) 38
HapII CCGG 2 cut(s) 155, 199
HpaII CCGG 2 cut(s) 155, 199
HphI GGTGA 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 22
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 65, 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 3 cut(s) 79, 97, 220
LmnI GCTCC 2 cut(s) 4, 116
LpnPI CCDG 8 cut(s) 96, 105, 130, 168, 195, 212, 222, 231
MaeI CTAG 2 cut(s) 8, 41
MalI GATC 3 cut(s) 81, 99, 222
MboI GATC 3 cut(s) 79, 97, 220
MboII GAAGA 1 cut(s) 70
MluCI AATT 1 cut(s) 91
Mph1103I ATGCAT 1 cut(s) 67
MseI TTAA 1 cut(s) 204
MspI CCGG 2 cut(s) 155, 199
MspR9I CCNGG 1 cut(s) 210
Mva1269I GAATGC 1 cut(s) 67
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeI CATATG 1 cut(s) 131
NdeII GATC 3 cut(s) 79, 97, 220
NlaIV GGNNCC 1 cut(s) 137
NsiI ATGCAT 1 cut(s) 67
PctI GAATGC 1 cut(s) 67
PfoI TCCNGGA 1 cut(s) 208
PkrI GCNGC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 3 cut(s) 79, 97, 220
ScrFI CCNGG 1 cut(s) 210
SetI ASST 4 cut(s) 9, 115, 121, 149
Sse9I AATT 1 cut(s) 91
SsiI CCGC 2 cut(s) 38, 237
SspMI CTAG 2 cut(s) 8, 41
StyD4I CCNGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 187
TaqII GACCGA 1 cut(s) 60
TasI AATT 1 cut(s) 91
TauI GCSGC 1 cut(s) 40
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
XapI RAATTY 1 cut(s) 91
XmiI GTMKAC 1 cut(s) 126
XspI CTAG 2 cut(s) 8, 41
Zsp2I ATGCAT 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.