Rmu_co8336279.1_g000001

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8336279.1
Physical Location & Seq
Forward (+)
1 .. 992
992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8336279.1_g000001.1.cds

Sequence Viewer

Length: 468 bp
gggtttattcgtgcttctgtgacccaagagcataatgcaacacagatgaagcccacaactccatttttggagataaaattaccagtgccaacagtggtaagtaaagagaaacaggctccactactagccactacatcacattcttctgtttctgattatcaaagaggtggagaggaggaagaggatgaagatgaagatgattgggatgcttttcagtcttttcctgctactacaaatgcagctgaaattgactcgagagtagacagtgccttggaaacacccgacctggttgagaaattgtctccttcggaagtgaatacagagagtgatcaatttcatggaaattctgtttcccaacctctcaacaatgtagatgctaccagcaaagcagaccatcaagaggctggcgaagctgaggtgatatctgattccctggatgatctgagatcctcacagggtaatatacta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

16.96

Weight (kDa)

4.16

Isoelectric Point (pI)

54.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 261
AclWI GGATC 1 cut(s) 441
AcsI RAATTY 1 cut(s) 343
AfiI CCNNNNNNNGG 1 cut(s) 400
AjnI CCWGG 2 cut(s) 285, 432
AluBI AGCT 2 cut(s) 242, 413
AluI AGCT 2 cut(s) 242, 413
Alw26I GTCTC 1 cut(s) 306
AlwI GGATC 1 cut(s) 441
Ama87I CYCGRG 1 cut(s) 253
ApeKI GCWGC 1 cut(s) 239
ApoI RAATTY 1 cut(s) 343
AsuHPI GGTGA 1 cut(s) 430
AvaI CYCGRG 1 cut(s) 253
BbvCI CCTCAGC 1 cut(s) 414
BbvI GCAGC 1 cut(s) 251
BccI CCATC 1 cut(s) 402
BciT130I CCWGG 2 cut(s) 287, 434
BclI TGATCA 1 cut(s) 328
BcoDI GTCTC 1 cut(s) 306
BfaI CTAG 1 cut(s) 125
BisI GCNGC 1 cut(s) 240
BlsI GCNGC 1 cut(s) 241
Bme1390I CCNGG 2 cut(s) 287, 434
BmeT110I CYCGRG 1 cut(s) 253
BmiI GGNNCC 1 cut(s) 117
BmrFI CCNGG 2 cut(s) 287, 434
BmsI GCATC 2 cut(s) 196, 364
Bpu10I CCTNAGC 1 cut(s) 414
BsaJI CCNNGG 2 cut(s) 270, 432
Bsc4I CCNNNNNNNGG 1 cut(s) 400
Bse1I ACTGG 1 cut(s) 83
BseBI CCWGG 2 cut(s) 287, 434
BseDI CCNNGG 2 cut(s) 270, 432
BseGI GGATG 3 cut(s) 190, 211, 442
BseLI CCNNNNNNNGG 1 cut(s) 400
BseMII CTCAG 2 cut(s) 405, 434
BseNI ACTGG 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 188
BseXI GCAGC 1 cut(s) 251
BsiHKCI CYCGRG 1 cut(s) 253
BslI CCNNNNNNNGG 1 cut(s) 400
BsmAI GTCTC 1 cut(s) 306
BsoBI CYCGRG 1 cut(s) 253
Bsp143I GATC 3 cut(s) 328, 439, 446
BspCNI CTCAG 2 cut(s) 406, 435
BspLI GGNNCC 1 cut(s) 117
BspPI GGATC 1 cut(s) 441
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 2 cut(s) 270, 432
BssMI GATC 3 cut(s) 328, 439, 446
BssT1I CCWWGG 1 cut(s) 270
Bst2UI CCWGG 2 cut(s) 287, 434
Bst4CI ACNGT 2 cut(s) 94, 266
Bst6I CTCTTC 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 406
BstDEI CTNAG 2 cut(s) 414, 443
BstF5I GGATG 3 cut(s) 190, 211, 442
BstKTI GATC 3 cut(s) 331, 442, 449
BstMAI GTCTC 1 cut(s) 306
BstMBI GATC 3 cut(s) 328, 439, 446
BstMWI GCNNNNNNNGC 1 cut(s) 410
BstNI CCWGG 2 cut(s) 287, 434
BstSCI CCNGG 2 cut(s) 285, 432
BstV1I GCAGC 1 cut(s) 251
BstX2I RGATCY 1 cut(s) 446
BstYI RGATCY 1 cut(s) 446
BtsCI GGATG 3 cut(s) 190, 211, 442
BtsIMutI CAGTG 3 cut(s) 90, 99, 271
Cac8I GCNNGC 1 cut(s) 406
CsiI ACCWGGT 1 cut(s) 285
CviAII CATG 1 cut(s) 338
CviJI RGCY 6 cut(s) 52, 116, 128, 242, 404, 413
CviKI_1 RGCY 6 cut(s) 52, 116, 128, 242, 404, 413
DdeI CTNAG 2 cut(s) 414, 443
DpnI GATC 3 cut(s) 330, 441, 448
DpnII GATC 3 cut(s) 328, 439, 446
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 270
Eco32I GATATC 1 cut(s) 423
Eco88I CYCGRG 1 cut(s) 253
EcoRII CCWGG 2 cut(s) 285, 432
EcoRV GATATC 1 cut(s) 423
EcoT14I CCWWGG 1 cut(s) 270
ErhI CCWWGG 1 cut(s) 270
FaeI CATG 1 cut(s) 341
FaiI YATR 3 cut(s) 33, 339, 464
FatI CATG 1 cut(s) 337
FbaI TGATCA 1 cut(s) 328
FblI GTMKAC 1 cut(s) 261
Fnu4HI GCNGC 1 cut(s) 240
FokI GGATG 3 cut(s) 197, 218, 449
Fsp4HI GCNGC 1 cut(s) 240
FspBI CTAG 1 cut(s) 125
GluI GCNGC 1 cut(s) 240
Hin1II CATG 1 cut(s) 341
HinfI GANTC 2 cut(s) 251, 428
HphI GGTGA 1 cut(s) 430
Hpy166II GTNNAC 1 cut(s) 262
Hpy188I TCNGA 4 cut(s) 154, 310, 427, 444
Hpy188III TCNNGA 2 cut(s) 255, 398
Hpy8I GTNNAC 1 cut(s) 262
HpyAV CCTTC 1 cut(s) 315
HpyCH4III ACNGT 2 cut(s) 94, 266
HpyCH4V TGCA 2 cut(s) 38, 239
HpyF10VI GCNNNNNNNGC 1 cut(s) 410
HpyF3I CTNAG 2 cut(s) 414, 443
Hsp92II CATG 1 cut(s) 341
Ksp22I TGATCA 1 cut(s) 328
Kzo9I GATC 3 cut(s) 328, 439, 446
LmnI GCTCC 1 cut(s) 121
Lsp1109I GCAGC 1 cut(s) 251
LweI GCATC 2 cut(s) 196, 364
MabI ACCWGGT 1 cut(s) 285
MaeI CTAG 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 19
MalI GATC 3 cut(s) 330, 441, 448
MboI GATC 3 cut(s) 328, 439, 446
MboII GAAGA 4 cut(s) 135, 191, 200, 206
MflI RGATCY 1 cut(s) 446
MluCI AATT 5 cut(s) 77, 246, 296, 332, 343
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 8 cut(s) 158, 166, 169, 175, 369, 394, 409, 460
MspA1I CMGCKG 1 cut(s) 242
MspR9I CCNGG 2 cut(s) 287, 434
MvaI CCWGG 2 cut(s) 287, 434
MwoI GCNNNNNNNGC 1 cut(s) 410
NdeII GATC 3 cut(s) 328, 439, 446
NlaIII CATG 1 cut(s) 341
NlaIV GGNNCC 1 cut(s) 117
NmuCI GTSAC 1 cut(s) 19
PaeR7I CTCGAG 1 cut(s) 253
PfeI GAWTC 1 cut(s) 428
PkrI GCNGC 1 cut(s) 241
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 285, 432
PspGI CCWGG 2 cut(s) 285, 432
PspN4I GGNNCC 1 cut(s) 117
PsuI RGATCY 1 cut(s) 446
PvuII CAGCTG 1 cut(s) 242
SatI GCNGC 1 cut(s) 240
Sau3AI GATC 3 cut(s) 328, 439, 446
SchI GAGTC 1 cut(s) 245
ScrFI CCNGG 2 cut(s) 287, 434
SetI ASST 6 cut(s) 169, 244, 288, 361, 415, 420
SexAI ACCWGGT 1 cut(s) 285
SfaNI GCATC 2 cut(s) 196, 364
Sfr274I CTCGAG 1 cut(s) 253
SlaI CTCGAG 1 cut(s) 253
SmlI CTYRAG 1 cut(s) 253
SmoI CTYRAG 1 cut(s) 253
Sse9I AATT 5 cut(s) 77, 246, 296, 332, 343
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 2 cut(s) 285, 432
StyI CCWWGG 1 cut(s) 270
TaaI ACNGT 2 cut(s) 94, 266
TaqI TCGA 1 cut(s) 254
TasI AATT 5 cut(s) 77, 246, 296, 332, 343
TfiI GAWTC 1 cut(s) 428
TscAI CASTG 3 cut(s) 90, 99, 271
TseFI GTSAC 1 cut(s) 19
TseI GCWGC 1 cut(s) 239
Tsp45I GTSAC 1 cut(s) 19
TspDTI ATGAA 4 cut(s) 62, 201, 207, 326
TspRI CASTG 3 cut(s) 90, 99, 271
XapI RAATTY 1 cut(s) 343
XcmI CCANNNNNNNNNTGG 1 cut(s) 401
XhoI CTCGAG 1 cut(s) 253
XmiI GTMKAC 1 cut(s) 261
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.