Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8361777.1

Orthogroup ID

OG0002980

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1062

Gene Structure 1062 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8361777.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 779 bp

catgcagtgttggtgatgatggtattcttcagatgagaaaaatattgggaacttgtctgaatgtgatcactggtttaaccaaggactgcattgagtgtattcatatgctggagaataagagatctgattcgcatacattactgcaaacaaagcttgctttctctcttgaacaaactatatcatttgccaagctgggttatgaaatggattatcttgaagataatacagatggtgattcaatttattatggtatgtttaaatattgcaccagacgtgtccaaactgtactcaccgattcaagtttacaggttcaagaaattgggttgcaagtactaaaaaacttgattcagaaaggcacagatgcagaggatgacactttcttaatgctttttgttggggaacttgcttgtgatttttccctgataatgcagaatatgctaaagaaacctgtaactgaaaaatcagcatctgttgctggtgaatgtttaagacttttagtgcttctgcaaacatcgtcaaaatctagcgaatgtcagagaggttttatgaatttgctcctggaagctgttctcgtggttttcaaggcttcagaagaaggttcttctcaggaagtcaataaacttaggagcattgcggtgagacttgtttctcatcttgctcaagttccttcctcagcagttcacttcaaggatgtgttgctgtctatgcctctgactcaccgacagcaatttcaggtgtcttcccccccccttttcgtgtgttatgtgcatatgtgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

258

Amino Acids

28.82

Weight (kDa)

5.7

Isoelectric Point (pI)

52.03

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002980)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G67140 AT1G67140 AT1G67140
fragaria_vesca	FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230 FvH4_6g45230
malus_domestica	MD12G1002400.v1.1 MD14G1001900.v1.1
prunus_persica	Prupe.7G002300_v2.0.a1 Prupe.7G002300_v2.0.a1 Prupe.7G002300_v2.0.a1 Prupe.7G002300_v2.0.a1
pyrus_communis	pycom12g00210 pycom49g00150 pycom49g00160
rosa_chinensis	RchiOBHm_Chr2g0162941 RchiOBHm_Chr2g0166391
rosa_laevigata	RLG00000021363
rosa_multiflora	Rmu_co8336279.1_g000001 Rmu_co8361777.1_g000001 Rmu_co8457597.1_g000001 Rmu_sc0000587.1_g000001
rosa_roxburghii	Rroxscaffold_2G00087690
rosa_rugosa	Rorug02G0499400
rosa_samantha	Rh2AG565500 Rh2AG588800 Rh2BG578200 Rh2CG547900 Rh2DG588400 Rh2DG611100
rosa_wichuraiana	Rw2G046810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	634
AcsI	RAATTY	1 cut(s)	549
AcuI	CTGAAG	2 cut(s)	13, 572
AfaI	GTAC	2 cut(s)	287, 332
AflIII	ACRYGT	1 cut(s)	273
AgsI	TTSAA	7 cut(s)	169, 217, 239, 299, 313, 582, 687
AjiI	CACGTC	1 cut(s)	274
AjnI	CCWGG	1 cut(s)	557
AluBI	AGCT	3 cut(s)	153, 192, 565
AluI	AGCT	3 cut(s)	153, 192, 565
Alw26I	GTCTC	1 cut(s)	633
AlwNI	CAGNNNCTG	1 cut(s)	469
ApoI	RAATTY	1 cut(s)	549
Asp700I	GAANNNNTTC	1 cut(s)	566
AsuHPI	GGTGA	6 cut(s)	25, 244, 282, 490, 648, 709
BauI	CACGAG	1 cut(s)	571
BbsI	GAAGAC	1 cut(s)	731
BbvCI	CCTCAGC	1 cut(s)	672
BccI	CCATC	2 cut(s)	13, 223
BciT130I	CCWGG	1 cut(s)	559
BclI	TGATCA	1 cut(s)	65
BcoDI	GTCTC	1 cut(s)	633
BfaI	CTAG	1 cut(s)	524
BglII	AGATCT	1 cut(s)	121
BmcAI	AGTACT	1 cut(s)	332
Bme1390I	CCNGG	1 cut(s)	559
BmgBI	CACGTC	1 cut(s)	274
BmrFI	CCNGG	1 cut(s)	559
BmsI	GCATC	2 cut(s)	351, 475
BpiI	GAAGAC	1 cut(s)	731
BpmI	CTGGAG	1 cut(s)	130
Bpu10I	CCTNAGC	1 cut(s)	672
BpuEI	CTTGAG	1 cut(s)	644
BsaJI	CCNNGG	1 cut(s)	80
Bse1I	ACTGG	1 cut(s)	75
Bse3DI	GCAATG	1 cut(s)	629
BseBI	CCWGG	1 cut(s)	559
BseDI	CCNNGG	1 cut(s)	80
BseGI	GGATG	2 cut(s)	375, 696
BseMI	GCAATG	1 cut(s)	629
BseMII	CTCAG	2 cut(s)	619, 686
BseNI	ACTGG	1 cut(s)	75
BseYI	CCCAGC	1 cut(s)	192
BsmAI	GTCTC	1 cut(s)	633
Bsp143I	GATC	2 cut(s)	65, 121
BspACI	CCGC	1 cut(s)	634
BspCNI	CTCAG	2 cut(s)	618, 685
BsrDI	GCAATG	1 cut(s)	629
BsrI	ACTGG	1 cut(s)	75
BssECI	CCNNGG	1 cut(s)	80
BssMI	GATC	2 cut(s)	65, 121
BssSI	CACGAG	1 cut(s)	571
BssT1I	CCWWGG	1 cut(s)	80
Bst2BI	CACGAG	1 cut(s)	571
Bst2UI	CCWGG	1 cut(s)	559
Bst4CI	ACNGT	1 cut(s)	285
BstAPI	GCANNNNNTGC	2 cut(s)	435, 472
BstC8I	GCNNGC	1 cut(s)	155
BstDEI	CTNAG	3 cut(s)	605, 622, 672
BstF5I	GGATG	2 cut(s)	375, 696
BstKTI	GATC	2 cut(s)	68, 124
BstMAI	GTCTC	1 cut(s)	633
BstMBI	GATC	2 cut(s)	65, 121
BstMWI	GCNNNNNNNGC	4 cut(s)	150, 435, 472, 705
BstNI	CCWGG	1 cut(s)	559
BstSCI	CCNGG	1 cut(s)	557
BstV2I	GAAGAC	1 cut(s)	731
BstX2I	RGATCY	1 cut(s)	121
BstYI	RGATCY	1 cut(s)	121
BtrI	CACGTC	1 cut(s)	274
BtsCI	GGATG	2 cut(s)	375, 696
BtsI	GCAGTG	1 cut(s)	12
BtsIMutI	CAGTG	2 cut(s)	12, 68
Cac8I	GCNNGC	1 cut(s)	155
CaiI	CAGNNNCTG	1 cut(s)	469
Csp6I	GTAC	2 cut(s)	286, 331
CviAII	CATG	1 cut(s)	2
CviJI	RGCY	4 cut(s)	153, 192, 565, 586
CviKI_1	RGCY	4 cut(s)	153, 192, 565, 586
CviQI	GTAC	2 cut(s)	286, 331
DdeI	CTNAG	3 cut(s)	605, 622, 672
DpnI	GATC	2 cut(s)	67, 123
DpnII	GATC	2 cut(s)	65, 121
DraI	TTTAAA	1 cut(s)	258
Eco130I	CCWWGG	1 cut(s)	80
Eco57I	CTGAAG	2 cut(s)	13, 572
EcoRII	CCWGG	1 cut(s)	557
EcoT14I	CCWWGG	1 cut(s)	80
ErhI	CCWWGG	1 cut(s)	80
FauNDI	CATATG	2 cut(s)	104, 770
FbaI	TGATCA	1 cut(s)	65
FokI	GGATG	2 cut(s)	382, 703
FspBI	CTAG	1 cut(s)	524
GsaI	CCCAGC	1 cut(s)	196
GsuI	CTGGAG	1 cut(s)	130
HindIII	AAGCTT	1 cut(s)	151
HinfI	GANTC	5 cut(s)	127, 235, 295, 345, 714
HphI	GGTGA	6 cut(s)	25, 244, 282, 490, 648, 709
Hpy166II	GTNNAC	2 cut(s)	304, 681
Hpy188I	TCNGA	7 cut(s)	32, 59, 126, 350, 536, 591, 713
Hpy188III	TCNNGA	4 cut(s)	166, 214, 313, 607
Hpy8I	GTNNAC	2 cut(s)	304, 681
HpyAV	CCTTC	2 cut(s)	589, 677
HpyCH4III	ACNGT	1 cut(s)	285
HpyCH4IV	ACGT	1 cut(s)	273
HpyCH4V	TGCA	9 cut(s)	5, 89, 144, 266, 327, 364, 429, 507, 768
HpyF10VI	GCNNNNNNNGC	4 cut(s)	150, 435, 472, 705
HpyF3I	CTNAG	3 cut(s)	605, 622, 672
HpySE526I	ACGT	1 cut(s)	273
Ksp22I	TGATCA	1 cut(s)	65
Kzo9I	GATC	2 cut(s)	65, 121
LmnI	GCTCC	2 cut(s)	560, 626
LweI	GCATC	2 cut(s)	351, 475
MaeI	CTAG	1 cut(s)	524
MaeII	ACGT	1 cut(s)	273
MaeIII	GTNAC	1 cut(s)	450
MalI	GATC	2 cut(s)	67, 123
MboI	GATC	2 cut(s)	65, 121
MboII	GAAGA	5 cut(s)	19, 229, 593, 604, 731
MflI	RGATCY	1 cut(s)	121
MluCI	AATT	4 cut(s)	239, 317, 549, 727
MlyI	GAGTC	1 cut(s)	708
MnlI	CCTC	4 cut(s)	360, 532, 681, 719
MroXI	GAANNNNTTC	1 cut(s)	566
MseI	TTAA	4 cut(s)	76, 257, 382, 487
MslI	CAYNNNNRTG	1 cut(s)	634
MspR9I	CCNGG	1 cut(s)	559
MvaI	CCWGG	1 cut(s)	559
MwoI	GCNNNNNNNGC	4 cut(s)	150, 435, 472, 705
NdeI	CATATG	2 cut(s)	104, 770
NdeII	GATC	2 cut(s)	65, 121
PdmI	GAANNNNTTC	1 cut(s)	566
PfeI	GAWTC	4 cut(s)	127, 235, 295, 345
PfoI	TCCNGGA	1 cut(s)	557
PleI	GAGTC	1 cut(s)	708
PpsI	GAGTC	1 cut(s)	708
Psp6I	CCWGG	1 cut(s)	557
PspFI	CCCAGC	1 cut(s)	192
PspGI	CCWGG	1 cut(s)	557
PstNI	CAGNNNCTG	1 cut(s)	469
PsuI	RGATCY	1 cut(s)	121
RsaI	GTAC	2 cut(s)	287, 332
RsaNI	GTAC	2 cut(s)	286, 331
RseI	CAYNNNNRTG	1 cut(s)	634
SaqAI	TTAA	4 cut(s)	76, 257, 382, 487
Sau3AI	GATC	2 cut(s)	65, 121
ScaI	AGTACT	1 cut(s)	332
SchI	GAGTC	1 cut(s)	708
ScrFI	CCNGG	1 cut(s)	559
SetI	ASST	9 cut(s)	155, 194, 276, 311, 450, 543, 567, 600, 737
SfaNI	GCATC	2 cut(s)	351, 475
SmiMI	CAYNNNNRTG	1 cut(s)	634
SmlI	CTYRAG	1 cut(s)	659
SmoI	CTYRAG	1 cut(s)	659
Sse9I	AATT	4 cut(s)	239, 317, 549, 727
SsiI	CCGC	1 cut(s)	634
SspI	AATATT	2 cut(s)	44, 262
SspMI	CTAG	1 cut(s)	524
StyD4I	CCNGG	1 cut(s)	557
StyI	CCWWGG	1 cut(s)	80
TaaI	ACNGT	1 cut(s)	285
TaiI	ACGT	1 cut(s)	276
TasI	AATT	4 cut(s)	239, 317, 549, 727
TatI	WGTACW	2 cut(s)	285, 330
TfiI	GAWTC	4 cut(s)	127, 235, 295, 345
Tru1I	TTAA	4 cut(s)	76, 257, 382, 487
Tru9I	TTAA	4 cut(s)	76, 257, 382, 487
TscAI	CASTG	2 cut(s)	12, 75
TspDTI	ATGAA	3 cut(s)	91, 215, 562
TspRI	CASTG	2 cut(s)	12, 75
XapI	RAATTY	1 cut(s)	549
XmnI	GAANNNNTTC	1 cut(s)	566
XspI	CTAG	1 cut(s)	524
ZrmI	AGTACT	1 cut(s)	332

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.