Rmu_co8457597.1_g000001

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8457597.1
Physical Location & Seq
Reverse (-)
88 .. 1764
1677 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8457597.1_g000001.1.cds

Sequence Viewer

Length: 1011 bp
ctgctaagcattagccaacaccccaagttcacttcgttcgagaggactcctgacccggagcttccagggcacctcctgctggaacaatatcaggcgcagctagtgtctgctgtccgcactgccttagactcgtcctctggtcctattcttttggaagcaggcttccagttggctacaaagatattcacaagtggaataattaagggtgatcagattgctgttaagcgcatatattctttgatttcgcgaccattgaatgacttcaaggacctgtattatccttcatttgcagaatgggtctcgtgcaagattaagataagacttcttgctgcccatgcttctctcaaatgttatacatatgcattcttgaggagacaccaaagtgcggttccagatgaatatttagcacttttaccattattttcaaagagttcaaacatgcttgggaagtactggattagagtcttgaaggactacagctatatttgcttgtgcgtgcatcttaaggcaaagtggaatccttttcttgatggaattcaatcacctctggtatcatcaaagttggagccctgcttggaagaatcatggccagtaatattgcaggcaattgcattggatgcagttccagtgaatcttgaagagaatgaatcttcaaaatccactgatgaaactacatcaagtaatagcttattgtctggatatagtatggttcaattggaatccgaagattatcagtttctctggggatttgctttgctagttttatttcaggggcaaaattcgacccccagtggattgaaaaatccagtttcttttgttaaagcttataacagggttgatccatccagtgaagaattatcttccccaggagttaatttatacgagattgtattaccggtcttccagtttttgtccaccaaaagatttgccagtgcaggatttctcactatggacatatgcagtgaattgcttcaggtggcaatccatatttcttcctcttgttcttgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

336

Amino Acids

37.5

Weight (kDa)

5.91

Isoelectric Point (pI)

46.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 828
AccB1I GGYRCC 1 cut(s) 69
AccII CGCG 1 cut(s) 247
AciI CCGC 2 cut(s) 115, 386
AclWI GGATC 1 cut(s) 833
AcoI YGGCCR 1 cut(s) 587
AcsI RAATTY 2 cut(s) 534, 778
AcuI CTGAAG 1 cut(s) 956
AfaI GTAC 1 cut(s) 452
AfiI CCNNNNNNNGG 2 cut(s) 79, 385
AflII CTTAAG 1 cut(s) 503
AgeI ACCGGT 1 cut(s) 895
AjnI CCWGG 2 cut(s) 64, 865
AjuI GAANNNNNNNTTGG 2 cut(s) 372, 404
AleI CACNNNNGTG 1 cut(s) 381
AluBI AGCT 5 cut(s) 61, 100, 480, 687, 824
AluI AGCT 5 cut(s) 61, 100, 480, 687, 824
Alw26I GTCTC 2 cut(s) 304, 367
AlwI GGATC 1 cut(s) 833
AoxI GGCC 1 cut(s) 587
ApeKI GCWGC 2 cut(s) 97, 329
ApoI RAATTY 2 cut(s) 534, 778
AsiGI ACCGGT 1 cut(s) 895
Asp700I GAANNNNTTC 2 cut(s) 260, 969
AspLEI GCGC 2 cut(s) 97, 228
AspS9I GGNCC 2 cut(s) 140, 268
AsuC2I CCSGG 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 218, 534
AvaII GGWCC 2 cut(s) 140, 268
BaeGI GKGCMC 1 cut(s) 72
BalI TGGCCA 1 cut(s) 589
BanI GGYRCC 1 cut(s) 69
BanII GRGCYC 1 cut(s) 570
BauI CACGAG 1 cut(s) 301
BbsI GAAGAC 1 cut(s) 892
BbvI GCAGC 2 cut(s) 109, 316
BccI CCATC 2 cut(s) 524, 850
BciT130I CCWGG 2 cut(s) 66, 867
BclI TGATCA 1 cut(s) 208
BcnI CCSGG 1 cut(s) 56
BcoDI GTCTC 2 cut(s) 304, 367
BfaI CTAG 2 cut(s) 101, 758
BfmI CTRYAG 1 cut(s) 475
BfrI CTTAAG 1 cut(s) 503
BisI GCNGC 2 cut(s) 98, 330
BlpI GCTNAGC 1 cut(s) 5
BlsI GCNGC 2 cut(s) 99, 331
BmcAI AGTACT 1 cut(s) 452
Bme1390I CCNGG 3 cut(s) 56, 66, 867
Bme18I GGWCC 2 cut(s) 140, 268
BmgT120I GGNCC 2 cut(s) 140, 268
BmiI GGNNCC 3 cut(s) 71, 390, 567
BmrFI CCNGG 3 cut(s) 56, 66, 867
BmrI ACTGGG 1 cut(s) 783
BmsI GCATC 2 cut(s) 508, 607
BmuI ACTGGG 1 cut(s) 783
BpiI GAAGAC 1 cut(s) 892
Bpu1102I GCTNAGC 1 cut(s) 5
BpuEI CTTGAG 1 cut(s) 388
BpuMI CCSGG 1 cut(s) 56
BsaI GGTCTC 1 cut(s) 304
BsaJI CCNNGG 2 cut(s) 65, 865
BsaWI WCCGGW 1 cut(s) 895
Bsc4I CCNNNNNNNGG 2 cut(s) 79, 385
Bse118I RCCGGY 1 cut(s) 895
Bse1I ACTGG 9 cut(s) 166, 458, 590, 626, 789, 806, 846, 904, 930
BseBI CCWGG 2 cut(s) 66, 867
BseDI CCNNGG 2 cut(s) 65, 865
BseGI GGATG 2 cut(s) 622, 842
BseLI CCNNNNNNNGG 2 cut(s) 79, 385
BseNI ACTGG 9 cut(s) 166, 458, 590, 626, 789, 806, 846, 904, 930
BseRI GAGGAG 1 cut(s) 385
BseSI GKGCMC 1 cut(s) 72
BseXI GCAGC 2 cut(s) 109, 316
BsgI GTGCAG 1 cut(s) 954
Bsh1236I CGCG 1 cut(s) 247
BshFI GGCC 1 cut(s) 589
BshNI GGYRCC 1 cut(s) 69
BshTI ACCGGT 1 cut(s) 895
BsiSI CCGG 2 cut(s) 56, 896
BslI CCNNNNNNNGG 2 cut(s) 79, 385
BsmAI GTCTC 2 cut(s) 304, 367
BsmI GAATGC 1 cut(s) 362
BsnI GGCC 1 cut(s) 589
Bso31I GGTCTC 1 cut(s) 304
Bsp1286I GDGCHC 2 cut(s) 72, 570
Bsp143I GATC 2 cut(s) 208, 838
Bsp1720I GCTNAGC 1 cut(s) 5
Bsp68I TCGCGA 1 cut(s) 247
BspACI CCGC 2 cut(s) 115, 386
BspANI GGCC 1 cut(s) 589
BspFNI CGCG 1 cut(s) 247
BspLI GGNNCC 3 cut(s) 71, 390, 567
BspPI GGATC 1 cut(s) 833
BspT107I GGYRCC 1 cut(s) 69
BspTI CTTAAG 1 cut(s) 503
BspTNI GGTCTC 1 cut(s) 304
BsrFI RCCGGY 1 cut(s) 895
BsrI ACTGG 9 cut(s) 166, 458, 590, 626, 789, 806, 846, 904, 930
BssAI RCCGGY 1 cut(s) 895
BssECI CCNNGG 2 cut(s) 65, 865
BssMI GATC 2 cut(s) 208, 838
BssSI CACGAG 1 cut(s) 301
Bst2BI CACGAG 1 cut(s) 301
Bst2UI CCWGG 2 cut(s) 66, 867
Bst6I CTCTTC 1 cut(s) 633
BstAFI CTTAAG 1 cut(s) 503
BstAPI GCANNNNNTGC 2 cut(s) 76, 617
BstC8I GCNNGC 3 cut(s) 160, 497, 603
BstDEI CTNAG 2 cut(s) 5, 124
BstF5I GGATG 2 cut(s) 622, 842
BstFNI CGCG 1 cut(s) 247
BstHHI GCGC 2 cut(s) 97, 228
BstKTI GATC 2 cut(s) 211, 841
BstMAI GTCTC 2 cut(s) 304, 367
BstMBI GATC 2 cut(s) 208, 838
BstMWI GCNNNNNNNGC 5 cut(s) 67, 76, 335, 486, 617
BstNI CCWGG 2 cut(s) 66, 867
BstNSI RCATGY 1 cut(s) 442
BstSCI CCNGG 3 cut(s) 54, 64, 865
BstSFI CTRYAG 1 cut(s) 475
BstSLI GKGCMC 1 cut(s) 72
BstUI CGCG 1 cut(s) 247
BstV1I GCAGC 2 cut(s) 109, 316
BstV2I GAAGAC 1 cut(s) 892
BsuRI GGCC 1 cut(s) 589
BtsCI GGATG 2 cut(s) 622, 842
BtsI GCAGTG 2 cut(s) 117, 967
BtsIMutI CAGTG 7 cut(s) 117, 633, 660, 796, 853, 937, 967
BtuMI TCGCGA 1 cut(s) 247
Cac8I GCNNGC 3 cut(s) 160, 497, 603
CfoI GCGC 2 cut(s) 97, 228
Cfr10I RCCGGY 1 cut(s) 895
Cfr13I GGNCC 2 cut(s) 140, 268
Csp6I GTAC 1 cut(s) 451
CspAI ACCGGT 1 cut(s) 895
CviAII CATG 3 cut(s) 335, 439, 585
CviQI GTAC 1 cut(s) 451
DdeI CTNAG 2 cut(s) 5, 124
DpnI GATC 2 cut(s) 210, 840
DpnII GATC 2 cut(s) 208, 838
EaeI YGGCCR 1 cut(s) 587
Eam1104I CTCTTC 1 cut(s) 633
EarI CTCTTC 1 cut(s) 633
Eco24I GRGCYC 1 cut(s) 570
Eco31I GGTCTC 1 cut(s) 304
Eco47I GGWCC 2 cut(s) 140, 268
Eco57I CTGAAG 1 cut(s) 956
EcoO109I RGGNCCY 1 cut(s) 268
EcoRI GAATTC 1 cut(s) 534
EcoRII CCWGG 2 cut(s) 64, 865
EcoT22I ATGCAT 1 cut(s) 364
EcoT38I GRGCYC 1 cut(s) 570
FaeI CATG 3 cut(s) 338, 442, 588
FatI CATG 3 cut(s) 334, 438, 584
FauNDI CATATG 2 cut(s) 358, 956
FbaI TGATCA 1 cut(s) 208
Fnu4HI GCNGC 2 cut(s) 98, 330
FokI GGATG 2 cut(s) 629, 829
FriOI GRGCYC 1 cut(s) 570
Fsp4HI GCNGC 2 cut(s) 98, 330
FspBI CTAG 2 cut(s) 101, 758
GlaI GCGC 2 cut(s) 96, 227
GluI GCNGC 2 cut(s) 98, 330
HaeIII GGCC 1 cut(s) 589
HapII CCGG 2 cut(s) 56, 896
HhaI GCGC 2 cut(s) 97, 228
Hin1II CATG 3 cut(s) 338, 442, 588
Hin6I GCGC 2 cut(s) 95, 226
HinP1I GCGC 2 cut(s) 95, 226
HindIII AAGCTT 1 cut(s) 822
HinfI GANTC 8 cut(s) 46, 128, 462, 517, 581, 631, 647, 719
HpaII CCGG 2 cut(s) 56, 896
HphI GGTGA 2 cut(s) 218, 534
Hpy166II GTNNAC 2 cut(s) 30, 915
Hpy188I TCNGA 2 cut(s) 213, 724
Hpy188III TCNNGA 9 cut(s) 40, 50, 246, 367, 392, 466, 527, 635, 696
Hpy8I GTNNAC 2 cut(s) 30, 915
HpyAV CCTTC 2 cut(s) 291, 463
HpyCH4V TGCA 9 cut(s) 290, 306, 362, 499, 601, 611, 620, 935, 960
HpyF10VI GCNNNNNNNGC 5 cut(s) 67, 76, 335, 486, 617
HpyF3I CTNAG 2 cut(s) 5, 124
Hsp92II CATG 3 cut(s) 338, 442, 588
HspAI GCGC 2 cut(s) 95, 226
Ksp22I TGATCA 1 cut(s) 208
Kzo9I GATC 2 cut(s) 208, 838
LmnI GCTCC 2 cut(s) 58, 565
Lsp1109I GCAGC 2 cut(s) 109, 316
LweI GCATC 2 cut(s) 508, 607
MaeI CTAG 2 cut(s) 101, 758
MalI GATC 2 cut(s) 210, 840
MboI GATC 2 cut(s) 208, 838
MboII GAAGA 8 cut(s) 590, 642, 650, 737, 852, 863, 892, 984
MfeI CAATTG 2 cut(s) 606, 713
MhlI GDGCHC 2 cut(s) 72, 570
MlsI TGGCCA 1 cut(s) 589
MluCI AATT 8 cut(s) 198, 534, 606, 713, 778, 854, 874, 965
MluNI TGGCCA 1 cut(s) 589
MlyI GAGTC 3 cut(s) 40, 122, 471
MmeI TCCRAC 1 cut(s) 543
MnlI CCTC 6 cut(s) 36, 83, 145, 363, 555, 1006
Mox20I TGGCCA 1 cut(s) 589
Mph1103I ATGCAT 1 cut(s) 364
MroXI GAANNNNTTC 2 cut(s) 260, 969
MscI TGGCCA 1 cut(s) 589
MseI TTAA 7 cut(s) 201, 222, 312, 504, 819, 873, 1009
MslI CAYNNNNRTG 1 cut(s) 381
Msp20I TGGCCA 1 cut(s) 589
MspCI CTTAAG 1 cut(s) 503
MspI CCGG 2 cut(s) 56, 896
MspR9I CCNGG 3 cut(s) 56, 66, 867
MunI CAATTG 2 cut(s) 606, 713
Mva1269I GAATGC 1 cut(s) 362
MvaI CCWGG 2 cut(s) 66, 867
MvnI CGCG 1 cut(s) 247
MwoI GCNNNNNNNGC 5 cut(s) 67, 76, 335, 486, 617
NciI CCSGG 1 cut(s) 56
NdeI CATATG 2 cut(s) 358, 956
NdeII GATC 2 cut(s) 208, 838
NlaIII CATG 3 cut(s) 338, 442, 588
NlaIV GGNNCC 3 cut(s) 71, 390, 567
NruI TCGCGA 1 cut(s) 247
NsiI ATGCAT 1 cut(s) 364
NspI RCATGY 1 cut(s) 442
OliI CACNNNNGTG 1 cut(s) 381
PctI GAATGC 1 cut(s) 362
PdmI GAANNNNTTC 2 cut(s) 260, 969
PfeI GAWTC 5 cut(s) 517, 581, 631, 647, 719
PinAI ACCGGT 1 cut(s) 895
PkrI GCNGC 2 cut(s) 99, 331
PleI GAGTC 3 cut(s) 40, 122, 470
PpsI GAGTC 3 cut(s) 40, 122, 470
PpuMI RGGWCCY 1 cut(s) 268
PsiI TTATAA 1 cut(s) 828
Psp5II RGGWCCY 1 cut(s) 268
Psp6I CCWGG 2 cut(s) 64, 865
PspGI CCWGG 2 cut(s) 64, 865
PspN4I GGNNCC 3 cut(s) 71, 390, 567
PspPI GGNCC 2 cut(s) 140, 268
PspPPI RGGWCCY 1 cut(s) 268
RruI TCGCGA 1 cut(s) 247
RsaI GTAC 1 cut(s) 452
RsaNI GTAC 1 cut(s) 451
RseI CAYNNNNRTG 1 cut(s) 381
SaqAI TTAA 7 cut(s) 201, 222, 312, 504, 819, 873, 1009
SatI GCNGC 2 cut(s) 98, 330
Sau3AI GATC 2 cut(s) 208, 838
Sau96I GGNCC 2 cut(s) 140, 268
ScaI AGTACT 1 cut(s) 452
SchI GAGTC 3 cut(s) 40, 122, 471
ScrFI CCNGG 3 cut(s) 56, 66, 867
SduI GDGCHC 2 cut(s) 72, 570
SetI ASST 9 cut(s) 63, 75, 102, 273, 482, 547, 689, 826, 978
SfaNI GCATC 2 cut(s) 508, 607
SfcI CTRYAG 1 cut(s) 475
SinI GGWCC 2 cut(s) 140, 268
SmiMI CAYNNNNRTG 1 cut(s) 381
SmlI CTYRAG 2 cut(s) 367, 503
SmoI CTYRAG 2 cut(s) 367, 503
Sse9I AATT 8 cut(s) 198, 534, 606, 713, 778, 854, 874, 965
SsiI CCGC 2 cut(s) 115, 386
SspI AATATT 2 cut(s) 401, 597
SspMI CTAG 2 cut(s) 101, 758
StyD4I CCNGG 3 cut(s) 54, 64, 865
TaqI TCGA 2 cut(s) 39, 782
TasI AATT 8 cut(s) 198, 534, 606, 713, 778, 854, 874, 965
TatI WGTACW 1 cut(s) 450
TfiI GAWTC 5 cut(s) 517, 581, 631, 647, 719
Tru1I TTAA 7 cut(s) 201, 222, 312, 504, 819, 873, 1009
Tru9I TTAA 7 cut(s) 201, 222, 312, 504, 819, 873, 1009
TscAI CASTG 7 cut(s) 124, 633, 667, 796, 853, 937, 967
TseI GCWGC 2 cut(s) 97, 329
TspDTI ATGAA 4 cut(s) 273, 411, 660, 681
TspRI CASTG 7 cut(s) 124, 633, 667, 796, 853, 937, 967
Vha464I CTTAAG 1 cut(s) 503
VpaK11BI GGWCC 2 cut(s) 140, 268
XapI RAATTY 2 cut(s) 534, 778
XceI RCATGY 1 cut(s) 442
XmnI GAANNNNTTC 2 cut(s) 260, 969
XspI CTAG 2 cut(s) 101, 758
ZrmI AGTACT 1 cut(s) 452
Zsp2I ATGCAT 1 cut(s) 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.