Rh2AG588800

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
82006796 .. 82009041
2246 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG588800.1

Sequence Viewer

Length: 333 bp
ATGCCTCTGACTCACCGACAGCAATCTCAGGGGTTTATTCGTGTTTCTGTGACTCAAGAGCATAAAGCAACCAAGATGAAGCCCACAACTCCATTTTTGGAGATAAAATTACCAGTGCCAACAGTGTTGCTTGGGATTGGTAGGCTGACCAGGGAGTACCGAATTGAGGACAATGCTGGTTCTGTATCTAAGGGTGTTGAAATTGATGGTGGTGTGGAAGTTGTGGATGGTTTTGAAGAGAATAAAGAAGAGGACAAACAACCAAATGAGTCAGGGGCATTGCAATCAGGCAGTGGGCCGGGATTTATGACAATGATGGAATACAGCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

12.12

Weight (kDa)

5.39

Isoelectric Point (pI)

58.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 166
AgsI TTSAA 2 cut(s) 200, 236
AjnI CCWGG 1 cut(s) 149
AoxI GGCC 1 cut(s) 296
AspS9I GGNCC 1 cut(s) 296
AsuC2I CCSGG 1 cut(s) 300
AsuHPI GGTGA 1 cut(s) 5
BccI CCATC 3 cut(s) 200, 221, 310
BciT130I CCWGG 1 cut(s) 151
BcnI CCSGG 1 cut(s) 300
Bme1390I CCNGG 2 cut(s) 151, 300
BmgT120I GGNCC 1 cut(s) 296
BmrFI CCNGG 2 cut(s) 151, 300
BpuEI CTTGAG 1 cut(s) 39
BpuMI CCSGG 1 cut(s) 300
BsaJI CCNNGG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 113
Bse3DI GCAATG 1 cut(s) 278
BseBI CCWGG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 150
BseGI GGATG 1 cut(s) 232
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMI GCAATG 1 cut(s) 278
BseMII CTCAG 1 cut(s) 41
BseNI ACTGG 1 cut(s) 113
BshFI GGCC 1 cut(s) 298
BsiSI CCGG 1 cut(s) 299
BslI CCNNNNNNNGG 1 cut(s) 166
BsnI GGCC 1 cut(s) 298
BspANI GGCC 1 cut(s) 298
BspCNI CTCAG 1 cut(s) 40
BsrDI GCAATG 1 cut(s) 278
BsrI ACTGG 1 cut(s) 113
BssECI CCNNGG 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 124
Bst6I CTCTTC 2 cut(s) 231, 243
BstDEI CTNAG 2 cut(s) 27, 189
BstF5I GGATG 1 cut(s) 232
BstNI CCWGG 1 cut(s) 151
BstSCI CCNGG 2 cut(s) 149, 298
BsuRI GGCC 1 cut(s) 298
BtsCI GGATG 1 cut(s) 232
BtsI GCAGTG 1 cut(s) 298
BtsIMutI CAGTG 3 cut(s) 120, 129, 298
Cfr13I GGNCC 1 cut(s) 296
Csp6I GTAC 1 cut(s) 157
CviJI RGCY 3 cut(s) 82, 145, 298
CviKI_1 RGCY 3 cut(s) 82, 145, 298
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 2 cut(s) 27, 189
Eam1104I CTCTTC 2 cut(s) 231, 243
EarI CTCTTC 2 cut(s) 231, 243
EcoRII CCWGG 1 cut(s) 149
FaiI YATR 2 cut(s) 63, 308
FokI GGATG 1 cut(s) 239
HaeIII GGCC 1 cut(s) 298
HapII CCGG 1 cut(s) 299
HinfI GANTC 3 cut(s) 10, 52, 269
HpaII CCGG 1 cut(s) 299
HphI GGTGA 1 cut(s) 5
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 56
HpyCH4III ACNGT 1 cut(s) 124
HpyCH4V TGCA 1 cut(s) 283
HpyF3I CTNAG 2 cut(s) 27, 189
LpnPI CCDG 8 cut(s) 14, 126, 136, 162, 163, 258, 273, 312
MaeIII GTNAC 1 cut(s) 49
MboII GAAGA 2 cut(s) 248, 260
MluCI AATT 3 cut(s) 107, 162, 201
MlyI GAGTC 3 cut(s) 4, 46, 278
MnlI CCTC 3 cut(s) 15, 160, 244
MspI CCGG 1 cut(s) 299
MspR9I CCNGG 2 cut(s) 151, 300
MvaI CCWGG 1 cut(s) 151
NciI CCSGG 1 cut(s) 300
NmuCI GTSAC 1 cut(s) 49
PleI GAGTC 3 cut(s) 4, 46, 277
PpsI GAGTC 3 cut(s) 4, 46, 277
Psp6I CCWGG 1 cut(s) 149
PspGI CCWGG 1 cut(s) 149
PspPI GGNCC 1 cut(s) 296
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
Sau96I GGNCC 1 cut(s) 296
SchI GAGTC 3 cut(s) 4, 46, 278
ScrFI CCNGG 2 cut(s) 151, 300
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
Sse9I AATT 3 cut(s) 107, 162, 201
StyD4I CCNGG 2 cut(s) 149, 298
TaaI ACNGT 1 cut(s) 124
TasI AATT 3 cut(s) 107, 162, 201
TscAI CASTG 3 cut(s) 120, 129, 298
TseFI GTSAC 1 cut(s) 49
Tsp45I GTSAC 1 cut(s) 49
TspDTI ATGAA 1 cut(s) 92
TspRI CASTG 3 cut(s) 120, 129, 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.