Rmu_co8338597.1_g000001

Protein FLUORESCENT IN BLUE LIGHT

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8338597.1
Physical Location & Seq
Reverse (-)
2 .. 984
983 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8338597.1_g000001.1.cds

Sequence Viewer

Length: 322 bp
atggcagtggtagctcgtttctcttgcttcttcactcaccccaagacctccgcccgatctccaccctccgatcaattctccctcaagtccaccctcctcgaaccatggaagtcggcgtttcttccatttaaagtcgaagcgtttggagagaatcaaattgaggtgttggagatgtcgccggccacaaaatgtcagggagctacagaattgagattcccagcaatggagcttctgctcggaaatgccttaatgttcactgcacctttgaatgctttggcagaaacatgtgaggccgacaactcttttttcaacatgcctctgc

Protein Analysis

107

Amino Acids

11.82

Weight (kDa)

5.03

Isoelectric Point (pI)

49.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 51
AcoI YGGCCR 1 cut(s) 180
AfiI CCNNNNNNNGG 1 cut(s) 223
AflIII ACRYGT 1 cut(s) 284
AgsI TTSAA 2 cut(s) 268, 310
AluBI AGCT 3 cut(s) 14, 200, 229
AluI AGCT 3 cut(s) 14, 200, 229
AoxI GGCC 2 cut(s) 180, 291
AsuHPI GGTGA 1 cut(s) 29
BfmI CTRYAG 1 cut(s) 201
BpuEI CTTGAG 1 cut(s) 68
BsaJI CCNNGG 1 cut(s) 104
Bsc4I CCNNNNNNNGG 1 cut(s) 223
Bse118I RCCGGY 1 cut(s) 178
Bse3DI GCAATG 1 cut(s) 228
BseDI CCNNGG 1 cut(s) 104
BseLI CCNNNNNNNGG 1 cut(s) 223
BseMI GCAATG 1 cut(s) 228
BseRI GAGGAG 1 cut(s) 86
BseYI CCCAGC 1 cut(s) 217
BsgI GTGCAG 1 cut(s) 243
BshFI GGCC 2 cut(s) 182, 293
BsiSI CCGG 1 cut(s) 179
BslI CCNNNNNNNGG 1 cut(s) 223
BsmI GAATGC 1 cut(s) 274
BsnI GGCC 2 cut(s) 182, 293
Bsp143I GATC 2 cut(s) 56, 70
Bsp19I CCATGG 1 cut(s) 104
BspACI CCGC 1 cut(s) 51
BspANI GGCC 2 cut(s) 182, 293
BsrDI GCAATG 1 cut(s) 228
BsrFI RCCGGY 1 cut(s) 178
BssAI RCCGGY 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 2 cut(s) 56, 70
BssT1I CCWWGG 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 180
BstDSI CCRYGG 1 cut(s) 104
BstKTI GATC 2 cut(s) 59, 73
BstMBI GATC 2 cut(s) 56, 70
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNSI RCATGY 2 cut(s) 288, 316
BstSFI CTRYAG 1 cut(s) 201
BsuRI GGCC 2 cut(s) 182, 293
BtgI CCRYGG 1 cut(s) 104
BtsI GCAGTG 2 cut(s) 12, 255
BtsIMutI CAGTG 2 cut(s) 12, 255
Cac8I GCNNGC 1 cut(s) 180
Cfr10I RCCGGY 1 cut(s) 178
CviAII CATG 3 cut(s) 105, 285, 313
CviJI RGCY 5 cut(s) 14, 182, 200, 229, 293
CviKI_1 RGCY 5 cut(s) 14, 182, 200, 229, 293
DpnI GATC 2 cut(s) 58, 72
DpnII GATC 2 cut(s) 56, 70
DraI TTTAAA 1 cut(s) 130
EaeI YGGCCR 1 cut(s) 180
EciI GGCGGA 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 104
EcoT14I CCWWGG 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 104
FaeI CATG 3 cut(s) 108, 288, 316
FaiI YATR 3 cut(s) 106, 286, 314
FatI CATG 3 cut(s) 104, 284, 312
GsaI CCCAGC 1 cut(s) 221
HaeIII GGCC 2 cut(s) 182, 293
HapII CCGG 1 cut(s) 179
Hin1II CATG 3 cut(s) 108, 288, 316
HinfI GANTC 2 cut(s) 151, 213
HpaII CCGG 1 cut(s) 179
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 2 cut(s) 90, 255
Hpy188I TCNGA 2 cut(s) 70, 239
Hpy8I GTNNAC 2 cut(s) 90, 255
HpyCH4V TGCA 1 cut(s) 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
Hsp92II CATG 3 cut(s) 108, 288, 316
KroI GCCGGC 1 cut(s) 178
KroNI GCCGGC 1 cut(s) 180
Kzo9I GATC 2 cut(s) 56, 70
LmnI GCTCC 2 cut(s) 197, 226
LpnPI CCDG 3 cut(s) 179, 192, 231
MalI GATC 2 cut(s) 58, 72
MboI GATC 2 cut(s) 56, 70
MboII GAAGA 2 cut(s) 22, 113
MluCI AATT 3 cut(s) 74, 156, 206
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 7 cut(s) 58, 76, 92, 104, 107, 154, 283
MroNI GCCGGC 1 cut(s) 178
MseI TTAA 2 cut(s) 129, 248
MspI CCGG 1 cut(s) 179
Mva1269I GAATGC 1 cut(s) 274
MwoI GCNNNNNNNGC 1 cut(s) 11
NaeI GCCGGC 1 cut(s) 180
NcoI CCATGG 1 cut(s) 104
NdeII GATC 2 cut(s) 56, 70
NgoMIV GCCGGC 1 cut(s) 178
NlaIII CATG 3 cut(s) 108, 288, 316
NspI RCATGY 2 cut(s) 288, 316
PciI ACATGT 1 cut(s) 284
PctI GAATGC 1 cut(s) 274
PdiI GCCGGC 1 cut(s) 180
PfeI GAWTC 2 cut(s) 151, 213
PscI ACATGT 1 cut(s) 284
PspFI CCCAGC 1 cut(s) 217
SaqAI TTAA 2 cut(s) 129, 248
Sau3AI GATC 2 cut(s) 56, 70
SetI ASST 6 cut(s) 16, 50, 165, 202, 231, 265
SfcI CTRYAG 1 cut(s) 201
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 3 cut(s) 74, 156, 206
SsiI CCGC 1 cut(s) 51
StyI CCWWGG 1 cut(s) 104
TaqI TCGA 2 cut(s) 99, 135
TasI AATT 3 cut(s) 74, 156, 206
TfiI GAWTC 2 cut(s) 151, 213
Tru1I TTAA 2 cut(s) 129, 248
Tru9I TTAA 2 cut(s) 129, 248
TscAI CASTG 2 cut(s) 12, 262
TspRI CASTG 2 cut(s) 12, 262
XceI RCATGY 2 cut(s) 288, 316
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.