Rmu_co8360041.1_g000001
ERF Family

Thioesterase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8360041.1
Physical Location & Seq
Reverse (-)
177 .. 926
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8360041.1_g000001.1.cds

Sequence Viewer

Length: 288 bp
atgggagctcacctggcttctagtttacaaagggtggctggaattcaactcagcatcaaccacttgaaccaagctgagctcggtgatcttatctacactgaagcctcacccatcagcgttggcaaaaccattcaggtttgggaggtgcgactttcaaagatagatccttcaaactcagacatcaaatccctagtatcatcatcaagagttactcttctgtgcaacatgcatgtgccagagcatgcaaaagatgcaggtcaagccctcaagaagtatgccaaattatag

Protein Analysis

95

Amino Acids

10.29

Weight (kDa)

8.85

Isoelectric Point (pI)

30.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 245
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 42
AcuI CTGAAG 1 cut(s) 120
AgsI TTSAA 4 cut(s) 47, 67, 156, 171
AjnI CCWGG 1 cut(s) 12
AluBI AGCT 3 cut(s) 8, 74, 79
AluI AGCT 3 cut(s) 8, 74, 79
Alw21I GWGCWC 2 cut(s) 10, 81
AlwI GGATC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 42
AsuHPI GGTGA 2 cut(s) 95, 99
BanII GRGCYC 2 cut(s) 10, 81
Bbv12I GWGCWC 2 cut(s) 10, 81
BccI CCATC 1 cut(s) 119
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 2 cut(s) 21, 191
BfuAI ACCTGC 1 cut(s) 245
BlpI GCTNAGC 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 14
BmrFI CCNGG 1 cut(s) 14
BmsI GCATC 2 cut(s) 63, 241
Bpu1102I GCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 251
BseBI CCWGG 1 cut(s) 14
BseMII CTCAG 3 cut(s) 64, 66, 189
BsiHKAI GWGCWC 2 cut(s) 10, 81
Bsp1286I GDGCHC 2 cut(s) 10, 81
Bsp143I GATC 2 cut(s) 85, 163
Bsp1720I GCTNAGC 1 cut(s) 75
BspCNI CTCAG 3 cut(s) 63, 67, 188
BspMI ACCTGC 1 cut(s) 245
BspPI GGATC 1 cut(s) 158
BssMI GATC 2 cut(s) 85, 163
Bst2UI CCWGG 1 cut(s) 14
Bst6I CTCTTC 1 cut(s) 219
BstAPI GCANNNNNTGC 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 243
BstDEI CTNAG 3 cut(s) 50, 75, 175
BstKTI GATC 2 cut(s) 88, 166
BstMBI GATC 2 cut(s) 85, 163
BstMWI GCNNNNNNNGC 3 cut(s) 14, 251, 260
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 3 cut(s) 229, 233, 245
BstSCI CCNGG 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 163
BstYI RGATCY 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 96
BveI ACCTGC 1 cut(s) 245
Cac8I GCNNGC 1 cut(s) 243
CviAII CATG 3 cut(s) 226, 230, 242
CviJI RGCY 7 cut(s) 8, 17, 38, 74, 79, 104, 263
CviKI_1 RGCY 7 cut(s) 8, 17, 38, 74, 79, 104, 263
DdeI CTNAG 3 cut(s) 50, 75, 175
DpnI GATC 2 cut(s) 87, 165
DpnII GATC 2 cut(s) 85, 163
Eam1104I CTCTTC 1 cut(s) 219
EarI CTCTTC 1 cut(s) 219
Ecl136II GAGCTC 2 cut(s) 8, 79
Eco24I GRGCYC 2 cut(s) 10, 81
Eco53kI GAGCTC 2 cut(s) 8, 79
Eco57I CTGAAG 1 cut(s) 120
EcoICRI GAGCTC 2 cut(s) 8, 79
EcoRI GAATTC 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 12
EcoT22I ATGCAT 1 cut(s) 231
EcoT38I GRGCYC 2 cut(s) 10, 81
FaeI CATG 3 cut(s) 229, 233, 245
FaiI YATR 5 cut(s) 227, 231, 243, 276, 286
FatI CATG 3 cut(s) 225, 229, 241
FriOI GRGCYC 2 cut(s) 10, 81
FspBI CTAG 2 cut(s) 21, 191
Hin1II CATG 3 cut(s) 229, 233, 245
HphI GGTGA 2 cut(s) 95, 99
Hpy166II GTNNAC 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 178
Hpy188III TCNNGA 2 cut(s) 204, 268
Hpy8I GTNNAC 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 177
HpyCH4V TGCA 4 cut(s) 222, 229, 245, 254
HpyF10VI GCNNNNNNNGC 3 cut(s) 14, 251, 260
HpyF3I CTNAG 3 cut(s) 50, 75, 175
Hsp92II CATG 3 cut(s) 229, 233, 245
Kzo9I GATC 2 cut(s) 85, 163
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 5 cut(s) 24, 26, 119, 240, 249
LweI GCATC 2 cut(s) 63, 241
MaeI CTAG 2 cut(s) 21, 191
MaeIII GTNAC 1 cut(s) 208
MalI GATC 2 cut(s) 87, 165
MboI GATC 2 cut(s) 85, 163
MboII GAAGA 1 cut(s) 206
MflI RGATCY 1 cut(s) 163
MhlI GDGCHC 2 cut(s) 10, 81
MluCI AATT 2 cut(s) 42, 281
MnlI CCTC 3 cut(s) 115, 136, 275
Mph1103I ATGCAT 1 cut(s) 231
MslI CAYNNNNRTG 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 14
MvaI CCWGG 1 cut(s) 14
MwoI GCNNNNNNNGC 3 cut(s) 14, 251, 260
NdeII GATC 2 cut(s) 85, 163
NlaIII CATG 3 cut(s) 229, 233, 245
NsiI ATGCAT 1 cut(s) 231
NspI RCATGY 3 cut(s) 229, 233, 245
PaeI GCATGC 1 cut(s) 245
Psp124BI GAGCTC 2 cut(s) 10, 81
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PsuI RGATCY 1 cut(s) 163
RseI CAYNNNNRTG 1 cut(s) 230
SacI GAGCTC 2 cut(s) 10, 81
Sau3AI GATC 2 cut(s) 85, 163
ScrFI CCNGG 1 cut(s) 14
SduI GDGCHC 2 cut(s) 10, 81
SetI ASST 7 cut(s) 10, 15, 76, 81, 138, 147, 259
SfaNI GCATC 2 cut(s) 63, 241
SmiMI CAYNNNNRTG 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 266
SmoI CTYRAG 1 cut(s) 266
SphI GCATGC 1 cut(s) 245
Sse9I AATT 2 cut(s) 42, 281
SspMI CTAG 2 cut(s) 21, 191
SstI GAGCTC 2 cut(s) 10, 81
StyD4I CCNGG 1 cut(s) 12
TasI AATT 2 cut(s) 42, 281
TscAI CASTG 1 cut(s) 103
TspRI CASTG 1 cut(s) 103
XapI RAATTY 1 cut(s) 42
XceI RCATGY 3 cut(s) 229, 233, 245
XspI CTAG 2 cut(s) 21, 191
Zsp2I ATGCAT 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.