Rmu_co8382301.1_g000001

glycerophosphoryl diester phosphodiesterase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8382301.1
OG0012678
Physical Location & Seq
Reverse (-)
1 .. 718
718 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8382301.1_g000001.1.cds

Sequence Viewer

Length: 328 bp
atgtcaagtgatggagttaccttctgcttagattccgtagacctcaactcaggcaccaatgcattgactcaattcatgaccaagacccaactgcagagtccctacagaaccaaggaaaacgtgtgtagaaacccagctaacaaggatgcaggcaaactggtgacccttgacaaattcctagagttagccaaggaaaaggcaactactggaattttgattgacattcagaatgcgccgttcctagcatcaaaggcgggtctggacattgttggtattgtaacctctgccaggaaaaaatgccacactcgacaagcaatcgactcaaaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576 GO:0016020 GO:0031224 GO:0031225 GO:0044425 GO:0048046
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GDPD

Protein Analysis

109

Amino Acids

11.82

Weight (kDa)

9.1

Isoelectric Point (pI)

30.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 53
AccI GTMKAC 1 cut(s) 39
AciI CCGC 1 cut(s) 254
AcsI RAATTY 2 cut(s) 173, 210
AfiI CCNNNNNNNGG 1 cut(s) 288
AflIII ACRYGT 1 cut(s) 120
AjnI CCWGG 1 cut(s) 287
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
ApoI RAATTY 2 cut(s) 173, 210
AspLEI GCGC 1 cut(s) 235
AsuHPI GGTGA 1 cut(s) 172
BanI GGYRCC 1 cut(s) 53
BccI CCATC 1 cut(s) 5
BceAI ACGGC 1 cut(s) 220
BciT130I CCWGG 1 cut(s) 289
BfaI CTAG 2 cut(s) 179, 242
BfmI CTRYAG 2 cut(s) 92, 103
Bme1390I CCNGG 1 cut(s) 289
BmiI GGNNCC 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 289
BmsI GCATC 2 cut(s) 136, 254
BsaJI CCNNGG 2 cut(s) 111, 189
Bsc4I CCNNNNNNNGG 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 162, 211
BseBI CCWGG 1 cut(s) 289
BseDI CCNNGG 2 cut(s) 111, 189
BseGI GGATG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 288
BseMII CTCAG 1 cut(s) 63
BseNI ACTGG 2 cut(s) 162, 211
BseYI CCCAGC 1 cut(s) 133
BshNI GGYRCC 1 cut(s) 53
BslFI GGGAC 1 cut(s) 84
BslI CCNNNNNNNGG 1 cut(s) 288
BsmFI GGGAC 1 cut(s) 84
BsmI GAATGC 1 cut(s) 235
BspACI CCGC 1 cut(s) 254
BspCNI CTCAG 1 cut(s) 62
BspHI TCATGA 1 cut(s) 75
BspLI GGNNCC 1 cut(s) 55
BspMAI CTGCAG 1 cut(s) 96
BspT107I GGYRCC 1 cut(s) 53
BsrI ACTGG 2 cut(s) 162, 211
BssECI CCNNGG 2 cut(s) 111, 189
BssT1I CCWWGG 2 cut(s) 111, 189
Bst2UI CCWGG 1 cut(s) 289
BstC8I GCNNGC 1 cut(s) 151
BstDEI CTNAG 2 cut(s) 28, 49
BstEII GGTNACC 1 cut(s) 160
BstENI CCTNNNNNAGG 1 cut(s) 286
BstF5I GGATG 1 cut(s) 151
BstHHI GCGC 1 cut(s) 235
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstNI CCWGG 1 cut(s) 289
BstPI GGTNACC 1 cut(s) 160
BstSCI CCNGG 1 cut(s) 287
BstSFI CTRYAG 2 cut(s) 92, 103
BtsCI GGATG 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 151
CciI TCATGA 1 cut(s) 75
CfoI GCGC 1 cut(s) 235
CviAII CATG 1 cut(s) 76
CviJI RGCY 2 cut(s) 137, 188
CviKI_1 RGCY 2 cut(s) 137, 188
DdeI CTNAG 2 cut(s) 28, 49
Eco130I CCWWGG 2 cut(s) 111, 189
Eco91I GGTNACC 1 cut(s) 160
EcoNI CCTNNNNNAGG 1 cut(s) 286
EcoO65I GGTNACC 1 cut(s) 160
EcoRII CCWGG 1 cut(s) 287
EcoT14I CCWWGG 2 cut(s) 111, 189
EcoT22I ATGCAT 1 cut(s) 64
ErhI CCWWGG 2 cut(s) 111, 189
FaeI CATG 1 cut(s) 79
FaiI YATR 1 cut(s) 77
FaqI GGGAC 1 cut(s) 84
FatI CATG 1 cut(s) 75
FauI CCCGC 1 cut(s) 247
FblI GTMKAC 1 cut(s) 39
FokI GGATG 1 cut(s) 158
FspBI CTAG 2 cut(s) 179, 242
GlaI GCGC 1 cut(s) 234
GsaI CCCAGC 1 cut(s) 137
HhaI GCGC 1 cut(s) 235
Hin1II CATG 1 cut(s) 79
Hin6I GCGC 1 cut(s) 233
HinP1I GCGC 1 cut(s) 233
HinfI GANTC 4 cut(s) 32, 67, 97, 320
HphI GGTGA 1 cut(s) 172
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 228
Hpy188III TCNNGA 2 cut(s) 76, 260
Hpy8I GTNNAC 1 cut(s) 40
HpyAV CCTTC 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 3 cut(s) 62, 94, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
HpyF3I CTNAG 2 cut(s) 28, 49
HpySE526I ACGT 1 cut(s) 120
Hsp92II CATG 1 cut(s) 79
HspAI GCGC 1 cut(s) 233
LpnPI CCDG 8 cut(s) 36, 135, 143, 147, 192, 245, 274, 301
LweI GCATC 2 cut(s) 136, 254
MaeI CTAG 2 cut(s) 179, 242
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 3 cut(s) 16, 160, 277
MluCI AATT 3 cut(s) 71, 173, 210
MlyI GAGTC 3 cut(s) 61, 106, 314
MnlI CCTC 2 cut(s) 53, 292
Mph1103I ATGCAT 1 cut(s) 64
MspR9I CCNGG 1 cut(s) 289
Mva1269I GAATGC 1 cut(s) 235
MvaI CCWGG 1 cut(s) 289
MwoI GCNNNNNNNGC 1 cut(s) 251
NlaIII CATG 1 cut(s) 79
NlaIV GGNNCC 1 cut(s) 55
NmuCI GTSAC 1 cut(s) 160
NsiI ATGCAT 1 cut(s) 64
PagI TCATGA 1 cut(s) 75
PctI GAATGC 1 cut(s) 235
PfeI GAWTC 1 cut(s) 32
PleI GAGTC 3 cut(s) 61, 105, 314
PpsI GAGTC 3 cut(s) 61, 105, 314
Psp6I CCWGG 1 cut(s) 287
PspEI GGTNACC 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 133
PspGI CCWGG 1 cut(s) 287
PspN4I GGNNCC 1 cut(s) 55
PstI CTGCAG 1 cut(s) 96
SchI GAGTC 3 cut(s) 61, 106, 314
ScrFI CCNGG 1 cut(s) 289
SetI ASST 5 cut(s) 23, 45, 123, 139, 284
SfaNI GCATC 2 cut(s) 136, 254
SfcI CTRYAG 2 cut(s) 92, 103
Sse9I AATT 3 cut(s) 71, 173, 210
SsiI CCGC 1 cut(s) 254
SspMI CTAG 2 cut(s) 179, 242
StyD4I CCNGG 1 cut(s) 287
StyI CCWWGG 2 cut(s) 111, 189
TaiI ACGT 1 cut(s) 123
TaqI TCGA 2 cut(s) 307, 318
TasI AATT 3 cut(s) 71, 173, 210
TfiI GAWTC 1 cut(s) 32
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 1 cut(s) 64
TspGWI ACGGA 1 cut(s) 25
XagI CCTNNNNNAGG 1 cut(s) 286
XapI RAATTY 2 cut(s) 173, 210
XmiI GTMKAC 1 cut(s) 39
XspI CTAG 2 cut(s) 179, 242
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.