Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000772.1

Orthogroup ID

OG0012678

Physical Location & Seq

Genomic Coordinates Forward (+)

55892 .. 56510

Gene Structure 619 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000772.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

atgatcaagagtgagactatccctgaacttcaacctgaagctggattcttctcgttccagctcacatgggaagagattcagtccttaaaaccccgactgcaaagtccctatggaaccaaggaaaacgtgtatagaaacccagataacaaggatgcaggcaaactggtgacccttaatgaattcctagagttcgccaaggaaaaggcaactactggaattttgatcgacattcaggtaaacctttcaagacgtttggctccaaaaccagctggtgtgcaaacagtctcttttgggcgagtggttgcgcaggcgtgccagcaccgcagggtgcagtcgttgggggagtcccgtgacctgacttctttttcaagcgctgtggacgaggagagcaccaacctcgtcacatggttcttttcttgccttccggaaaaggatttcttgccttacgcgggtaagggctttggttgtggtctctttgcgttcaccaaatcgatactcaacgttgtaggttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576 GO:0016020 GO:0031224 GO:0031225 GO:0044425 GO:0048046

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GDPD

Protein Analysis

170

Amino Acids

18.93

Weight (kDa)

6.6

Isoelectric Point (pI)

47.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012678)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0317811
rosa_laevigata	RLG00000008297
rosa_multiflora	Rmu_co8382301.1_g000001 Rmu_sc0000654.1_g000044 Rmu_sc0000772.1_g000024 Rmu_sc0000772.1_g000027 Rmu_sc0000772.1_g000042 Rmu_sc0010905.1_g000001
rosa_samantha	Rh1AG029500 Rh1BG025600 Rh1CG027300 Rh1DG042500 Rh1DG043000 Rh1DG043100 Rh1DG043300 Rh1DG043800 Rh4BG172400
rosa_wichuraiana	Rw1G002160 Rw1G002190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	102
Acc16I	TGCGCA	1 cut(s)	306
AccII	CGCG	1 cut(s)	449
AccIII	TCCGGA	1 cut(s)	424
AciI	CCGC	2 cut(s)	322, 449
AclI	AACGTT	1 cut(s)	501
AcsI	RAATTY	2 cut(s)	179, 216
AcuI	CTGAAG	1 cut(s)	57
AfeI	AGCGCT	1 cut(s)	373
AfiI	CCNNNNNNNGG	2 cut(s)	41, 449
AflIII	ACRYGT	1 cut(s)	126
AgsI	TTSAA	3 cut(s)	32, 246, 369
AluBI	AGCT	3 cut(s)	41, 61, 269
AluI	AGCT	3 cut(s)	41, 61, 269
Alw21I	GWGCWC	1 cut(s)	392
Alw26I	GTCTC	3 cut(s)	8, 289, 476
Aor13HI	TCCGGA	1 cut(s)	424
Aor51HI	AGCGCT	1 cut(s)	373
ApoI	RAATTY	2 cut(s)	179, 216
Asp700I	GAANNNNTTC	1 cut(s)	75
AspLEI	GCGC	2 cut(s)	307, 374
AsuHPI	GGTGA	2 cut(s)	178, 475
Bbv12I	GWGCWC	1 cut(s)	392
BcgI	CGANNNNNNTGC	2 cut(s)	379, 413
BclI	TGATCA	1 cut(s)	3
BcoDI	GTCTC	3 cut(s)	8, 289, 476
BfaI	CTAG	1 cut(s)	185
BfoI	RGCGCY	1 cut(s)	375
BmiI	GGNNCC	2 cut(s)	115, 258
BmsI	GCATC	1 cut(s)	142
Bsa29I	ATCGAT	1 cut(s)	491
BsaI	GGTCTC	1 cut(s)	476
BsaJI	CCNNGG	2 cut(s)	117, 195
BsaWI	WCCGGW	1 cut(s)	424
Bsc4I	CCNNNNNNNGG	2 cut(s)	41, 449
Bse1I	ACTGG	2 cut(s)	168, 217
BseAI	TCCGGA	1 cut(s)	424
BseCI	ATCGAT	1 cut(s)	491
BseDI	CCNNGG	2 cut(s)	117, 195
BseGI	GGATG	1 cut(s)	157
BseLI	CCNNNNNNNGG	2 cut(s)	41, 449
BseNI	ACTGG	2 cut(s)	168, 217
BseRI	GAGGAG	1 cut(s)	398
BsgI	GTGCAG	1 cut(s)	350
Bsh1236I	CGCG	1 cut(s)	449
BshVI	ATCGAT	1 cut(s)	491
BsiHKAI	GWGCWC	1 cut(s)	392
BsiSI	CCGG	1 cut(s)	425
BslFI	GGGAC	2 cut(s)	90, 331
BslI	CCNNNNNNNGG	2 cut(s)	41, 449
BsmAI	GTCTC	3 cut(s)	8, 289, 476
BsmFI	GGGAC	2 cut(s)	90, 331
Bso31I	GGTCTC	1 cut(s)	476
Bsp1286I	GDGCHC	1 cut(s)	392
Bsp13I	TCCGGA	1 cut(s)	424
Bsp143I	GATC	2 cut(s)	3, 222
BspACI	CCGC	2 cut(s)	322, 449
BspDI	ATCGAT	1 cut(s)	491
BspEI	TCCGGA	1 cut(s)	424
BspFNI	CGCG	1 cut(s)	449
BspLI	GGNNCC	2 cut(s)	115, 258
BspTNI	GGTCTC	1 cut(s)	476
BsrI	ACTGG	2 cut(s)	168, 217
BssECI	CCNNGG	2 cut(s)	117, 195
BssMI	GATC	2 cut(s)	3, 222
BssT1I	CCWWGG	2 cut(s)	117, 195
Bst4CI	ACNGT	1 cut(s)	283
Bst6I	CTCTTC	1 cut(s)	66
BstC8I	GCNNGC	4 cut(s)	157, 309, 313, 317
BstEII	GGTNACC	1 cut(s)	166
BstF5I	GGATG	1 cut(s)	157
BstFNI	CGCG	1 cut(s)	449
BstH2I	RGCGCY	1 cut(s)	375
BstHHI	GCGC	2 cut(s)	307, 374
BstKTI	GATC	2 cut(s)	6, 225
BstMAI	GTCTC	3 cut(s)	8, 289, 476
BstMBI	GATC	2 cut(s)	3, 222
BstMWI	GCNNNNNNNGC	1 cut(s)	321
BstPI	GGTNACC	1 cut(s)	166
BstUI	CGCG	1 cut(s)	449
Bsu15I	ATCGAT	1 cut(s)	491
BsuTUI	ATCGAT	1 cut(s)	491
BtsCI	GGATG	1 cut(s)	157
Cac8I	GCNNGC	4 cut(s)	157, 309, 313, 317
CfoI	GCGC	2 cut(s)	307, 374
ClaI	ATCGAT	1 cut(s)	491
CspCI	CAANNNNNGTGG	2 cut(s)	357, 392
CviAII	CATG	2 cut(s)	66, 405
CviJI	RGCY	5 cut(s)	41, 61, 257, 269, 459
CviKI_1	RGCY	5 cut(s)	41, 61, 257, 269, 459
DpnI	GATC	2 cut(s)	5, 224
DpnII	GATC	2 cut(s)	3, 222
DrdI	GACNNNNNNGTC	1 cut(s)	102
DseDI	GACNNNNNNGTC	1 cut(s)	102
Eam1104I	CTCTTC	1 cut(s)	66
EarI	CTCTTC	1 cut(s)	66
Eco130I	CCWWGG	2 cut(s)	117, 195
Eco31I	GGTCTC	1 cut(s)	476
Eco47III	AGCGCT	1 cut(s)	373
Eco57I	CTGAAG	1 cut(s)	57
Eco91I	GGTNACC	1 cut(s)	166
EcoO65I	GGTNACC	1 cut(s)	166
EcoRI	GAATTC	1 cut(s)	179
EcoT14I	CCWWGG	2 cut(s)	117, 195
ErhI	CCWWGG	2 cut(s)	117, 195
FaeI	CATG	2 cut(s)	69, 408
FaiI	YATR	4 cut(s)	67, 111, 132, 406
FalI	AAGNNNNNCTT	2 cut(s)	422, 454
FaqI	GGGAC	2 cut(s)	90, 331
FatI	CATG	2 cut(s)	65, 404
FauI	CCCGC	1 cut(s)	442
FbaI	TGATCA	1 cut(s)	3
FokI	GGATG	1 cut(s)	164
FspBI	CTAG	1 cut(s)	185
FspI	TGCGCA	1 cut(s)	306
GlaI	GCGC	2 cut(s)	306, 373
HaeII	RGCGCY	1 cut(s)	375
HapII	CCGG	1 cut(s)	425
HhaI	GCGC	2 cut(s)	307, 374
Hin1II	CATG	2 cut(s)	69, 408
Hin6I	GCGC	2 cut(s)	305, 372
HinP1I	GCGC	2 cut(s)	305, 372
HinfI	GANTC	3 cut(s)	45, 76, 344
HpaII	CCGG	1 cut(s)	425
HphI	GGTGA	2 cut(s)	178, 475
Hpy166II	GTNNAC	3 cut(s)	238, 379, 483
Hpy188III	TCNNGA	3 cut(s)	7, 246, 425
Hpy8I	GTNNAC	3 cut(s)	238, 379, 483
HpyAV	CCTTC	1 cut(s)	431
HpyCH4III	ACNGT	1 cut(s)	283
HpyCH4IV	ACGT	3 cut(s)	126, 250, 501
HpyCH4V	TGCA	4 cut(s)	100, 155, 277, 331
HpyF10VI	GCNNNNNNNGC	1 cut(s)	321
HpySE526I	ACGT	3 cut(s)	126, 250, 501
Hsp92II	CATG	2 cut(s)	69, 408
HspAI	GCGC	2 cut(s)	305, 372
Kpn2I	TCCGGA	1 cut(s)	424
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	2 cut(s)	3, 222
LmnI	GCTCC	1 cut(s)	262
LweI	GCATC	1 cut(s)	142
MaeI	CTAG	1 cut(s)	185
MaeII	ACGT	3 cut(s)	126, 250, 501
MaeIII	GTNAC	3 cut(s)	166, 350, 400
MalI	GATC	2 cut(s)	5, 224
MboI	GATC	2 cut(s)	3, 222
MboII	GAAGA	2 cut(s)	40, 83
MhlI	GDGCHC	1 cut(s)	392
MluCI	AATT	2 cut(s)	179, 216
MlyI	GAGTC	1 cut(s)	353
MnlI	CCTC	2 cut(s)	376, 407
MroI	TCCGGA	1 cut(s)	424
MroXI	GAANNNNTTC	1 cut(s)	75
MseI	TTAA	2 cut(s)	86, 174
MspA1I	CMGCKG	1 cut(s)	269
MspI	CCGG	1 cut(s)	425
MvnI	CGCG	1 cut(s)	449
MwoI	GCNNNNNNNGC	1 cut(s)	321
NdeII	GATC	2 cut(s)	3, 222
NlaIII	CATG	2 cut(s)	69, 408
NlaIV	GGNNCC	2 cut(s)	115, 258
NmuCI	GTSAC	3 cut(s)	166, 350, 400
NsbI	TGCGCA	1 cut(s)	306
PdmI	GAANNNNTTC	1 cut(s)	75
PfeI	GAWTC	2 cut(s)	45, 76
PleI	GAGTC	1 cut(s)	352
PpsI	GAGTC	1 cut(s)	352
Psp1406I	AACGTT	1 cut(s)	501
PspEI	GGTNACC	1 cut(s)	166
PspN4I	GGNNCC	2 cut(s)	115, 258
PvuII	CAGCTG	1 cut(s)	269
SaqAI	TTAA	2 cut(s)	86, 174
Sau3AI	GATC	2 cut(s)	3, 222
SchI	GAGTC	1 cut(s)	353
SduI	GDGCHC	1 cut(s)	392
SfaNI	GCATC	1 cut(s)	142
Sse9I	AATT	2 cut(s)	179, 216
SsiI	CCGC	2 cut(s)	322, 449
SspMI	CTAG	1 cut(s)	185
StyI	CCWWGG	2 cut(s)	117, 195
TaaI	ACNGT	1 cut(s)	283
TaiI	ACGT	3 cut(s)	129, 253, 504
TaqI	TCGA	2 cut(s)	225, 491
TasI	AATT	2 cut(s)	179, 216
TfiI	GAWTC	2 cut(s)	45, 76
Tru1I	TTAA	2 cut(s)	86, 174
Tru9I	TTAA	2 cut(s)	86, 174
TseFI	GTSAC	3 cut(s)	166, 350, 400
Tsp45I	GTSAC	3 cut(s)	166, 350, 400
TspDTI	ATGAA	1 cut(s)	192
XapI	RAATTY	2 cut(s)	179, 216
XmnI	GAANNNNTTC	1 cut(s)	75
XspI	CTAG	1 cut(s)	185

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.