Rmu_co8385815.1_g000001

Syntaxin-52-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8385815.1
Physical Location & Seq
Reverse (-)
1 .. 1140
1140 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8385815.1_g000001.1.cds

Sequence Viewer

Length: 495 bp
atgatatctgaacggagttcatttcccgcatcaggtccagaaactcagcgtcatgtctctgctattcggaggaaaattacaatattggggactagacttgatagcttacagtccgaattgtcaacacttcctggaaagcagcccataacagccaaagagatgaatcgtcggaaggacatggttgcaaatttgagatcaaaagttaaccagatgtcttcaacgttgacatcaaactctggtaacagagacagcttgcttggacctgaaataagtaaagctgatgccatgggccgagcagctggcctggacaactatggccttgttggtctacagcgacaagttatgaaagagcaagatgaggggcttgacaaattggaggagactgtagtaagcacaaaacatattgcattggcagtcaatgaggaactcaccctgcacactaggcttattgatgatttggatgaacatgtggatgttactaactcccggctacgg

Protein Analysis

165

Amino Acids

18.25

Weight (kDa)

6.92

Isoelectric Point (pI)

54.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 328
AciI CCGC 1 cut(s) 27
AclI AACGTT 1 cut(s) 221
AcsI RAATTY 1 cut(s) 187
AfiI CCNNNNNNNGG 2 cut(s) 32, 492
AflIII ACRYGT 1 cut(s) 466
AgsI TTSAA 1 cut(s) 219
AjnI CCWGG 2 cut(s) 130, 303
AluBI AGCT 4 cut(s) 105, 252, 278, 299
AluI AGCT 4 cut(s) 105, 252, 278, 299
Alw26I GTCTC 3 cut(s) 61, 240, 374
AoxI GGCC 3 cut(s) 289, 301, 316
ApeKI GCWGC 2 cut(s) 139, 296
ApoI RAATTY 1 cut(s) 187
AspS9I GGNCC 3 cut(s) 35, 260, 289
AsuC2I CCSGG 1 cut(s) 487
AsuHPI GGTGA 1 cut(s) 421
AvaII GGWCC 2 cut(s) 35, 260
BbsI GAAGAC 1 cut(s) 207
BbvI GCAGC 2 cut(s) 151, 308
BciT130I CCWGG 2 cut(s) 132, 305
BcnI CCSGG 1 cut(s) 487
BcoDI GTCTC 3 cut(s) 61, 240, 374
BfaI CTAG 2 cut(s) 93, 441
BfmI CTRYAG 2 cut(s) 329, 384
BisI GCNGC 2 cut(s) 140, 297
BlsI GCNGC 2 cut(s) 141, 298
Bme1390I CCNGG 3 cut(s) 132, 305, 487
Bme18I GGWCC 2 cut(s) 35, 260
BmgT120I GGNCC 3 cut(s) 35, 260, 289
BmrFI CCNGG 3 cut(s) 132, 305, 487
BmsI GCATC 2 cut(s) 38, 271
BpiI GAAGAC 1 cut(s) 207
BpuMI CCSGG 1 cut(s) 487
BsaJI CCNNGG 1 cut(s) 285
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 492
BseBI CCWGG 2 cut(s) 132, 305
BseDI CCNNGG 1 cut(s) 285
BseGI GGATG 2 cut(s) 466, 478
BseLI CCNNNNNNNGG 2 cut(s) 32, 492
BseMII CTCAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 392
BseXI GCAGC 2 cut(s) 151, 308
BsgI GTGCAG 1 cut(s) 419
BshFI GGCC 3 cut(s) 291, 303, 318
BsiSI CCGG 1 cut(s) 487
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 2 cut(s) 32, 492
BsmAI GTCTC 3 cut(s) 61, 240, 374
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 3 cut(s) 291, 303, 318
Bsp143I GATC 1 cut(s) 194
Bsp19I CCATGG 1 cut(s) 285
BspACI CCGC 1 cut(s) 27
BspANI GGCC 3 cut(s) 291, 303, 318
BspCNI CTCAG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 285
BssMI GATC 1 cut(s) 194
BssT1I CCWWGG 1 cut(s) 285
Bst2UI CCWGG 2 cut(s) 132, 305
Bst4CI ACNGT 2 cut(s) 111, 385
BstC8I GCNNGC 2 cut(s) 254, 301
BstDEI CTNAG 1 cut(s) 45
BstDSI CCRYGG 1 cut(s) 285
BstF5I GGATG 2 cut(s) 466, 478
BstKTI GATC 1 cut(s) 197
BstMAI GTCTC 3 cut(s) 61, 240, 374
BstMBI GATC 1 cut(s) 194
BstMWI GCNNNNNNNGC 1 cut(s) 442
BstNI CCWGG 2 cut(s) 132, 305
BstNSI RCATGY 1 cut(s) 470
BstSCI CCNGG 3 cut(s) 130, 303, 485
BstSFI CTRYAG 2 cut(s) 329, 384
BstV1I GCAGC 2 cut(s) 151, 308
BstV2I GAAGAC 1 cut(s) 207
BsuRI GGCC 3 cut(s) 291, 303, 318
BtgI CCRYGG 1 cut(s) 285
BtsCI GGATG 2 cut(s) 466, 478
Cac8I GCNNGC 2 cut(s) 254, 301
Cfr13I GGNCC 3 cut(s) 35, 260, 289
CseI GACGC 1 cut(s) 38
CviAII CATG 4 cut(s) 53, 178, 286, 467
DdeI CTNAG 1 cut(s) 45
DpnI GATC 1 cut(s) 196
DpnII GATC 1 cut(s) 194
Eco130I CCWWGG 1 cut(s) 285
Eco32I GATATC 1 cut(s) 6
Eco47I GGWCC 2 cut(s) 35, 260
EcoRII CCWGG 2 cut(s) 130, 303
EcoRV GATATC 1 cut(s) 6
EcoT14I CCWWGG 1 cut(s) 285
ErhI CCWWGG 1 cut(s) 285
FaeI CATG 4 cut(s) 56, 181, 289, 470
FaiI YATR 8 cut(s) 54, 146, 179, 287, 315, 344, 402, 468
FaqI GGGAC 1 cut(s) 103
FatI CATG 4 cut(s) 52, 177, 285, 466
FauI CCCGC 1 cut(s) 34
FblI GTMKAC 1 cut(s) 328
Fnu4HI GCNGC 2 cut(s) 140, 297
FokI GGATG 2 cut(s) 473, 485
Fsp4HI GCNGC 2 cut(s) 140, 297
FspBI CTAG 2 cut(s) 93, 441
GluI GCNGC 2 cut(s) 140, 297
HaeIII GGCC 3 cut(s) 291, 303, 318
HapII CCGG 1 cut(s) 487
HgaI GACGC 1 cut(s) 38
Hin1II CATG 4 cut(s) 56, 181, 289, 470
HincII GTYRAC 3 cut(s) 123, 205, 225
HindII GTYRAC 3 cut(s) 123, 205, 225
HinfI GANTC 1 cut(s) 163
HpaI GTTAAC 1 cut(s) 205
HpaII CCGG 1 cut(s) 487
HphI GGTGA 1 cut(s) 421
Hpy166II GTNNAC 4 cut(s) 123, 205, 225, 329
Hpy188I TCNGA 4 cut(s) 10, 69, 115, 171
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 4 cut(s) 123, 205, 225, 329
Hpy99I CGWCG 1 cut(s) 171
HpyAV CCTTC 1 cut(s) 166
HpyCH4III ACNGT 2 cut(s) 111, 385
HpyCH4IV ACGT 1 cut(s) 221
HpyCH4V TGCA 3 cut(s) 185, 407, 436
HpyF10VI GCNNNNNNNGC 1 cut(s) 442
HpyF3I CTNAG 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 221
Hsp92II CATG 4 cut(s) 56, 181, 289, 470
KspAI GTTAAC 1 cut(s) 205
Kzo9I GATC 1 cut(s) 194
Lsp1109I GCAGC 2 cut(s) 151, 308
LweI GCATC 2 cut(s) 38, 271
MaeI CTAG 2 cut(s) 93, 441
MaeII ACGT 1 cut(s) 221
MaeIII GTNAC 2 cut(s) 239, 475
MalI GATC 1 cut(s) 196
MboI GATC 1 cut(s) 194
MboII GAAGA 1 cut(s) 207
MluCI AATT 4 cut(s) 75, 116, 187, 371
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 4 cut(s) 63, 352, 370, 415
MseI TTAA 1 cut(s) 204
MslI CAYNNNNRTG 1 cut(s) 471
MspA1I CMGCKG 1 cut(s) 299
MspI CCGG 1 cut(s) 487
MspR9I CCNGG 3 cut(s) 132, 305, 487
MvaI CCWGG 2 cut(s) 132, 305
MwoI GCNNNNNNNGC 1 cut(s) 442
NciI CCSGG 1 cut(s) 487
NcoI CCATGG 1 cut(s) 285
NdeII GATC 1 cut(s) 194
NlaIII CATG 4 cut(s) 56, 181, 289, 470
NmeAIII GCCGAG 1 cut(s) 317
NspI RCATGY 1 cut(s) 470
PciI ACATGT 1 cut(s) 466
PfeI GAWTC 1 cut(s) 163
PfoI TCCNGGA 1 cut(s) 130
PkrI GCNGC 2 cut(s) 141, 298
PscI ACATGT 1 cut(s) 466
Psp1406I AACGTT 1 cut(s) 221
Psp6I CCWGG 2 cut(s) 130, 303
PspGI CCWGG 2 cut(s) 130, 303
PspPI GGNCC 3 cut(s) 35, 260, 289
PvuII CAGCTG 1 cut(s) 299
RseI CAYNNNNRTG 1 cut(s) 471
SaqAI TTAA 1 cut(s) 204
SatI GCNGC 2 cut(s) 140, 297
Sau3AI GATC 1 cut(s) 194
Sau96I GGNCC 3 cut(s) 35, 260, 289
ScrFI CCNGG 3 cut(s) 132, 305, 487
SetI ASST 7 cut(s) 37, 107, 224, 254, 265, 280, 301
SfaNI GCATC 2 cut(s) 38, 271
SfcI CTRYAG 2 cut(s) 329, 384
SinI GGWCC 2 cut(s) 35, 260
SmiMI CAYNNNNRTG 1 cut(s) 471
Sse9I AATT 4 cut(s) 75, 116, 187, 371
SsiI CCGC 1 cut(s) 27
SspI AATATT 1 cut(s) 84
SspMI CTAG 2 cut(s) 93, 441
StyD4I CCNGG 3 cut(s) 130, 303, 485
StyI CCWWGG 1 cut(s) 285
TaaI ACNGT 2 cut(s) 111, 385
TaiI ACGT 1 cut(s) 224
TasI AATT 4 cut(s) 75, 116, 187, 371
TfiI GAWTC 1 cut(s) 163
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TseI GCWGC 2 cut(s) 139, 296
TspDTI ATGAA 4 cut(s) 9, 176, 359, 477
TspGWI ACGGA 1 cut(s) 28
VpaK11BI GGWCC 2 cut(s) 35, 260
XapI RAATTY 1 cut(s) 187
XceI RCATGY 1 cut(s) 470
XmiI GTMKAC 1 cut(s) 328
XspI CTAG 2 cut(s) 93, 441
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.