Rmu_co8392037.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8392037.1
OG0011391
Physical Location & Seq
Reverse (-)
1 .. 520
520 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8392037.1_g000001.1.cds

Sequence Viewer

Length: 261 bp
atgtgcaacaggggtcaagtcggtgatacatctagatcctatttccagggtcaaaggtccgatccaaaacatgctttagagacacagagcaacaacgatccccgatctcaacctcatattgaagatatggaccttgggtacgaggataagccttcgtcacagtcctttgaagttctggagcagaaattccttgatgacattaggaaactaaccaaggaacagaatgatgctgaggatgcagaaaatgctagacacagagag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

10.1

Weight (kDa)

4.87

Isoelectric Point (pI)

60.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011391)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G22040 AT5G22040 AT5G22040
fragaria_vesca FvH4_3g26150 FvH4_3g26150
malus_domestica MD03G1159500.v1.1 MD11G1174800.v1.1
prunus_persica Prupe.6G147200_v2.0.a1
pyrus_communis pycom03g11210 pycom11g14950
rosa_chinensis RchiOBHm_Chr5g0049091
rosa_laevigata RLG00000034588
rosa_multiflora Rmu_co8392037.1_g000001
rosa_roxburghii Rroxscaffold_1G00032780
rosa_rugosa Rorug05G0243100
rosa_samantha Rh5AG322600 Rh5BG333200 Rh5CG358100 Rh5DG344600
rosa_wichuraiana Rw5G030440

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 30, 56, 92
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 1 cut(s) 140
AgsI TTSAA 2 cut(s) 122, 170
AjnI CCWGG 1 cut(s) 45
Alw26I GTCTC 1 cut(s) 74
AlwI GGATC 3 cut(s) 30, 56, 92
ApoI RAATTY 1 cut(s) 185
AspS9I GGNCC 2 cut(s) 57, 130
AsuHPI GGTGA 1 cut(s) 35
AvaII GGWCC 2 cut(s) 57, 130
BbvCI CCTCAGC 1 cut(s) 231
BciT130I CCWGG 1 cut(s) 47
BcoDI GTCTC 1 cut(s) 74
BfaI CTAG 2 cut(s) 33, 249
Bme1390I CCNGG 1 cut(s) 47
Bme18I GGWCC 2 cut(s) 57, 130
BmgT120I GGNCC 2 cut(s) 57, 130
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 2 cut(s) 217, 226
BpmI CTGGAG 1 cut(s) 197
Bpu10I CCTNAGC 1 cut(s) 231
BsaJI CCNNGG 3 cut(s) 46, 133, 213
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 3 cut(s) 46, 133, 213
BseGI GGATG 1 cut(s) 241
BseMII CTCAG 1 cut(s) 222
BsmAI GTCTC 1 cut(s) 74
Bsp143I GATC 4 cut(s) 35, 61, 97, 104
BspCNI CTCAG 1 cut(s) 223
BspPI GGATC 3 cut(s) 30, 56, 92
BssECI CCNNGG 3 cut(s) 46, 133, 213
BssMI GATC 4 cut(s) 35, 61, 97, 104
BssT1I CCWWGG 2 cut(s) 133, 213
Bst2UI CCWGG 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 162
BstAPI GCANNNNNTGC 1 cut(s) 245
BstDEI CTNAG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 4 cut(s) 38, 64, 100, 107
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 4 cut(s) 35, 61, 97, 104
BstMWI GCNNNNNNNGC 2 cut(s) 236, 245
BstNI CCWGG 1 cut(s) 47
BstNSI RCATGY 1 cut(s) 74
BstSCI CCNGG 1 cut(s) 45
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
BtsCI GGATG 1 cut(s) 241
Cfr13I GGNCC 2 cut(s) 57, 130
Csp6I GTAC 1 cut(s) 139
CviAII CATG 1 cut(s) 71
CviJI RGCY 1 cut(s) 151
CviKI_1 RGCY 1 cut(s) 151
CviQI GTAC 1 cut(s) 139
DdeI CTNAG 1 cut(s) 231
DpnI GATC 4 cut(s) 37, 63, 99, 106
DpnII GATC 4 cut(s) 35, 61, 97, 104
Eco130I CCWWGG 2 cut(s) 133, 213
Eco47I GGWCC 2 cut(s) 57, 130
EcoRII CCWGG 1 cut(s) 45
EcoT14I CCWWGG 2 cut(s) 133, 213
ErhI CCWWGG 2 cut(s) 133, 213
FaeI CATG 1 cut(s) 74
FaiI YATR 3 cut(s) 72, 117, 128
FatI CATG 1 cut(s) 70
FokI GGATG 1 cut(s) 248
FspBI CTAG 2 cut(s) 33, 249
GsuI CTGGAG 1 cut(s) 197
Hin1II CATG 1 cut(s) 74
HphI GGTGA 1 cut(s) 35
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 33, 176
HpyAV CCTTC 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4V TGCA 2 cut(s) 6, 239
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 245
HpyF3I CTNAG 1 cut(s) 231
Hsp92II CATG 1 cut(s) 74
Kzo9I GATC 4 cut(s) 35, 61, 97, 104
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 3 cut(s) 32, 59, 161
LweI GCATC 2 cut(s) 217, 226
MaeI CTAG 2 cut(s) 33, 249
MaeIII GTNAC 1 cut(s) 156
MalI GATC 4 cut(s) 37, 63, 99, 106
MboI GATC 4 cut(s) 35, 61, 97, 104
MboII GAAGA 1 cut(s) 134
MflI RGATCY 1 cut(s) 35
MluCI AATT 1 cut(s) 185
MnlI CCTC 3 cut(s) 123, 136, 226
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 2 cut(s) 236, 245
NdeII GATC 4 cut(s) 35, 61, 97, 104
NlaIII CATG 1 cut(s) 74
NmuCI GTSAC 1 cut(s) 156
NspI RCATGY 1 cut(s) 74
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 2 cut(s) 57, 130
PsuI RGATCY 1 cut(s) 35
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
Sau3AI GATC 4 cut(s) 35, 61, 97, 104
Sau96I GGNCC 2 cut(s) 57, 130
ScrFI CCNGG 1 cut(s) 47
SetI ASST 3 cut(s) 59, 115, 135
SfaNI GCATC 2 cut(s) 217, 226
SinI GGWCC 2 cut(s) 57, 130
Sse9I AATT 1 cut(s) 185
SspMI CTAG 2 cut(s) 33, 249
StyD4I CCNGG 1 cut(s) 45
StyI CCWWGG 2 cut(s) 133, 213
TaaI ACNGT 1 cut(s) 162
TasI AATT 1 cut(s) 185
TseFI GTSAC 1 cut(s) 156
Tsp45I GTSAC 1 cut(s) 156
VpaK11BI GGWCC 2 cut(s) 57, 130
XapI RAATTY 1 cut(s) 185
XbaI TCTAGA 1 cut(s) 32
XceI RCATGY 1 cut(s) 74
XspI CTAG 2 cut(s) 33, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.