Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8395887.1

Orthogroup ID

OG0002031

Physical Location & Seq

Genomic Coordinates Forward (+)

528 .. 1238

Gene Structure 711 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8395887.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 711 bp

atgaatgataatgctgcagtaacatctgatggacgcttccttgcgactggaagttatgacactacaatcatggtctgggaagttttccgaggtagaacacaagaaaagagaccacgtaatacacagacggaactaccccgtaaagattatgtcattgttgaaactccttttcgtattctgtgcggacacgatgatataattacatgcttatatatcagtgtagagcttgacatagttatcagtggatcgaaagatggaacatgtgtttttcataccctgcagaagggaagatatgtaagatccgtgcgacatccatctggatgtgcgttatcaaagcttgttgcctctcggcatggaaggatagtgttttacgcagatggtgatctcagtttgcatctttattcaattaatggtaaacatcttgcttcttctgaatccaatggccgcctcaactgtgttgagctgagtgggtgtgaggaatttttggtttgtgctggtgaccacgggcaaatagttgtacgctccatgaattcacttgaggtcataaagaaatataatggagctggaaagatcataacatctctaacagtgaccccagaagaatgcttcttagctggaacaaaagacggaacccttcttgtgtattctatagaaaatcctcaacatcgcaaaggtgcccttcctcgaaattcaaaatccaaaccctcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Beach DUF4704 DUF4800 Laminin_G_3 PH_BEACH WD40

Protein Analysis

236

Amino Acids

26.05

Weight (kDa)

8.59

Isoelectric Point (pI)

26.75

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002031)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G58230 AT1G58230 AT1G58230
fragaria_vesca	FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530 FvH4_5g34530
malus_domestica	MD08G1199800.v1.1 MD08G1200500.v1.1 MD08G1200600.v1.1 MD15G1387600.v1.1
prunus_persica	Prupe.1G534000_v2.0.a1 Prupe.1G534000_v2.0.a1 Prupe.1G534000_v2.0.a1 Prupe.1G534000_v2.0.a1
pyrus_communis	pycom08g17380 pycom08g17390 pycom08g17400 pycom15g34760 pycom15g34770 pycom15g34780 pycom15g34790
rosa_chinensis	RchiOBHm_Chr7g0235181
rosa_laevigata	RLG00000001175
rosa_multiflora	Rmu_co8395887.1_g000001 Rmu_sc0004657.1_g000019
rosa_roxburghii	Rroxscaffold_3G00226200
rosa_rugosa	Rorug07G0288800 Rorug07G0288900
rosa_samantha	Rh7AG443400 Rh7BG416100 Rh7CG464500 Rh7DG432900
rosa_wichuraiana	Rw7G036860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	674
AciI	CCGC	2 cut(s)	183, 445
AclWI	GGATC	2 cut(s)	253, 294
AcoI	YGGCCR	1 cut(s)	442
AcsI	RAATTY	3 cut(s)	479, 529, 688
AfaI	GTAC	1 cut(s)	519
AfiI	CCNNNNNNNGG	1 cut(s)	283
AflIII	ACRYGT	1 cut(s)	260
AgsI	TTSAA	3 cut(s)	161, 405, 693
AluBI	AGCT	5 cut(s)	226, 337, 463, 563, 614
AluI	AGCT	5 cut(s)	226, 337, 463, 563, 614
Alw26I	GTCTC	1 cut(s)	103
AlwI	GGATC	2 cut(s)	253, 294
AoxI	GGCC	1 cut(s)	442
ApeKI	GCWGC	1 cut(s)	14
ApoI	RAATTY	3 cut(s)	479, 529, 688
AseI	ATTAAT	1 cut(s)	408
AsuHPI	GGTGA	2 cut(s)	392, 509
BaeGI	GKGCMC	1 cut(s)	679
BanI	GGYRCC	1 cut(s)	674
BccI	CCATC	4 cut(s)	23, 248, 322, 371
BcoDI	GTCTC	1 cut(s)	103
BfmI	CTRYAG	3 cut(s)	15, 278, 648
BisI	GCNGC	2 cut(s)	15, 445
BlsI	GCNGC	2 cut(s)	16, 446
BmiI	GGNNCC	2 cut(s)	631, 676
BmsI	GCATC	1 cut(s)	403
BpuEI	CTTGAG	1 cut(s)	557
BsaAI	YACGTR	1 cut(s)	116
BsaBI	GATNNNNATC	1 cut(s)	381
BsaI	GGTCTC	1 cut(s)	103
BsaJI	CCNNGG	2 cut(s)	88, 502
Bsc4I	CCNNNNNNNGG	1 cut(s)	283
Bse1I	ACTGG	1 cut(s)	52
Bse8I	GATNNNNATC	1 cut(s)	381
BseDI	CCNNGG	2 cut(s)	88, 502
BseGI	GGATG	2 cut(s)	310, 326
BseJI	GATNNNNATC	1 cut(s)	381
BseLI	CCNNNNNNNGG	1 cut(s)	283
BseMII	CTCAG	2 cut(s)	400, 455
BseNI	ACTGG	1 cut(s)	52
BseSI	GKGCMC	1 cut(s)	679
BshFI	GGCC	1 cut(s)	444
BshNI	GGYRCC	1 cut(s)	674
BslI	CCNNNNNNNGG	1 cut(s)	283
BsmAI	GTCTC	1 cut(s)	103
BsmI	GAATGC	1 cut(s)	608
BsnI	GGCC	1 cut(s)	444
Bso31I	GGTCTC	1 cut(s)	103
Bsp1286I	GDGCHC	1 cut(s)	679
Bsp143I	GATC	4 cut(s)	245, 299, 382, 570
BspACI	CCGC	2 cut(s)	183, 445
BspANI	GGCC	1 cut(s)	444
BspCNI	CTCAG	2 cut(s)	399, 456
BspLI	GGNNCC	2 cut(s)	631, 676
BspMAI	CTGCAG	2 cut(s)	19, 282
BspPI	GGATC	2 cut(s)	253, 294
BspT107I	GGYRCC	1 cut(s)	674
BspTNI	GGTCTC	1 cut(s)	103
BsrI	ACTGG	1 cut(s)	52
BssECI	CCNNGG	2 cut(s)	88, 502
BssMI	GATC	4 cut(s)	245, 299, 382, 570
Bst4CI	ACNGT	2 cut(s)	455, 589
BstBAI	YACGTR	1 cut(s)	116
BstDEI	CTNAG	3 cut(s)	386, 464, 610
BstDSI	CCRYGG	1 cut(s)	502
BstEII	GGTNACC	1 cut(s)	497
BstENI	CCTNNNNNAGG	1 cut(s)	281
BstF5I	GGATG	2 cut(s)	310, 326
BstKTI	GATC	4 cut(s)	248, 302, 385, 573
BstMAI	GTCTC	1 cut(s)	103
BstMBI	GATC	4 cut(s)	245, 299, 382, 570
BstNSI	RCATGY	2 cut(s)	207, 264
BstPI	GGTNACC	1 cut(s)	497
BstSFI	CTRYAG	3 cut(s)	15, 278, 648
BstSLI	GKGCMC	1 cut(s)	679
BstX2I	RGATCY	1 cut(s)	299
BstYI	RGATCY	1 cut(s)	299
BsuRI	GGCC	1 cut(s)	444
BtgI	CCRYGG	1 cut(s)	502
BtgZI	GCGATG	1 cut(s)	650
BtsCI	GGATG	2 cut(s)	310, 326
BtsIMutI	CAGTG	3 cut(s)	223, 247, 594
CseI	GACGC	1 cut(s)	42
Csp6I	GTAC	1 cut(s)	518
CviAII	CATG	5 cut(s)	70, 204, 261, 353, 526
CviJI	RGCY	6 cut(s)	226, 337, 444, 463, 563, 614
CviKI_1	RGCY	6 cut(s)	226, 337, 444, 463, 563, 614
CviQI	GTAC	1 cut(s)	518
DdeI	CTNAG	3 cut(s)	386, 464, 610
DpnI	GATC	4 cut(s)	247, 301, 384, 572
DpnII	GATC	4 cut(s)	245, 299, 382, 570
EaeI	YGGCCR	1 cut(s)	442
Eco31I	GGTCTC	1 cut(s)	103
Eco91I	GGTNACC	1 cut(s)	497
EcoNI	CCTNNNNNAGG	1 cut(s)	281
EcoO65I	GGTNACC	1 cut(s)	497
EcoRI	GAATTC	1 cut(s)	529
FaeI	CATG	5 cut(s)	73, 207, 264, 356, 529
FalI	AAGNNNNNCTT	2 cut(s)	663, 695
FatI	CATG	5 cut(s)	69, 203, 260, 352, 525
Fnu4HI	GCNGC	2 cut(s)	15, 445
FokI	GGATG	2 cut(s)	297, 333
Fsp4HI	GCNGC	2 cut(s)	15, 445
GluI	GCNGC	2 cut(s)	15, 445
HaeIII	GGCC	1 cut(s)	444
HgaI	GACGC	1 cut(s)	42
Hin1II	CATG	5 cut(s)	73, 207, 264, 356, 529
HindIII	AAGCTT	1 cut(s)	335
HinfI	GANTC	1 cut(s)	434
HphI	GGTGA	2 cut(s)	392, 509
Hpy166II	GTNNAC	1 cut(s)	416
Hpy188I	TCNGA	3 cut(s)	28, 89, 433
Hpy188III	TCNNGA	2 cut(s)	318, 708
Hpy8I	GTNNAC	1 cut(s)	416
HpyAV	CCTTC	4 cut(s)	277, 351, 644, 689
HpyCH4III	ACNGT	2 cut(s)	455, 589
HpyCH4IV	ACGT	1 cut(s)	115
HpyCH4V	TGCA	3 cut(s)	17, 280, 394
HpyF3I	CTNAG	3 cut(s)	386, 464, 610
HpySE526I	ACGT	1 cut(s)	115
Hsp92II	CATG	5 cut(s)	73, 207, 264, 356, 529
Kzo9I	GATC	4 cut(s)	245, 299, 382, 570
LmnI	GCTCC	2 cut(s)	527, 560
LpnPI	CCDG	8 cut(s)	33, 61, 290, 303, 480, 549, 600, 609
LweI	GCATC	1 cut(s)	403
MaeII	ACGT	1 cut(s)	115
MaeIII	GTNAC	3 cut(s)	19, 497, 589
MalI	GATC	4 cut(s)	247, 301, 384, 572
MboI	GATC	4 cut(s)	245, 299, 382, 570
MboII	GAAGA	3 cut(s)	300, 420, 611
MflI	RGATCY	1 cut(s)	299
MhlI	GDGCHC	1 cut(s)	679
MluCI	AATT	5 cut(s)	198, 405, 479, 529, 688
MnlI	CCTC	7 cut(s)	83, 355, 458, 469, 532, 669, 693
MseI	TTAA	1 cut(s)	408
MslI	CAYNNNNRTG	1 cut(s)	319
Mva1269I	GAATGC	1 cut(s)	608
NdeII	GATC	4 cut(s)	245, 299, 382, 570
NlaIII	CATG	5 cut(s)	73, 207, 264, 356, 529
NlaIV	GGNNCC	2 cut(s)	631, 676
NmeAIII	GCCGAG	1 cut(s)	328
NmuCI	GTSAC	2 cut(s)	497, 589
NspI	RCATGY	2 cut(s)	207, 264
PciI	ACATGT	1 cut(s)	260
PctI	GAATGC	1 cut(s)	608
PfeI	GAWTC	1 cut(s)	434
PkrI	GCNGC	2 cut(s)	16, 446
Ppu21I	YACGTR	1 cut(s)	116
PscI	ACATGT	1 cut(s)	260
PshBI	ATTAAT	1 cut(s)	408
PspEI	GGTNACC	1 cut(s)	497
PspN4I	GGNNCC	2 cut(s)	631, 676
PstI	CTGCAG	2 cut(s)	19, 282
PsuI	RGATCY	1 cut(s)	299
RsaI	GTAC	1 cut(s)	519
RsaNI	GTAC	1 cut(s)	518
RseI	CAYNNNNRTG	1 cut(s)	319
SaqAI	TTAA	1 cut(s)	408
SatI	GCNGC	2 cut(s)	15, 445
Sau3AI	GATC	4 cut(s)	245, 299, 382, 570
SduI	GDGCHC	1 cut(s)	679
SetI	ASST	9 cut(s)	94, 118, 228, 339, 465, 543, 565, 616, 676
SfaNI	GCATC	1 cut(s)	403
SfcI	CTRYAG	3 cut(s)	15, 278, 648
SmiMI	CAYNNNNRTG	1 cut(s)	319
SmlI	CTYRAG	1 cut(s)	536
SmoI	CTYRAG	1 cut(s)	536
Sse9I	AATT	5 cut(s)	198, 405, 479, 529, 688
SsiI	CCGC	2 cut(s)	183, 445
TaaI	ACNGT	2 cut(s)	455, 589
TaiI	ACGT	1 cut(s)	118
TaqI	TCGA	2 cut(s)	248, 685
TasI	AATT	5 cut(s)	198, 405, 479, 529, 688
TauI	GCSGC	1 cut(s)	447
TfiI	GAWTC	1 cut(s)	434
Tru1I	TTAA	1 cut(s)	408
Tru9I	TTAA	1 cut(s)	408
TscAI	CASTG	3 cut(s)	223, 247, 594
TseFI	GTSAC	2 cut(s)	497, 589
TseI	GCWGC	1 cut(s)	14
Tsp45I	GTSAC	2 cut(s)	497, 589
TspDTI	ATGAA	3 cut(s)	17, 260, 542
TspGWI	ACGGA	3 cut(s)	143, 292, 642
TspRI	CASTG	3 cut(s)	223, 247, 594
VspI	ATTAAT	1 cut(s)	408
XagI	CCTNNNNNAGG	1 cut(s)	281
XapI	RAATTY	3 cut(s)	479, 529, 688
XceI	RCATGY	2 cut(s)	207, 264

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.