Rmu_co8408345.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8408345.1
Physical Location & Seq
Reverse (-)
435 .. 1322
888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8408345.1_g000001.1.cds

Sequence Viewer

Length: 385 bp
atgtgggtctatatcaggccatttcatcaaagtgaatgattccaccaacatttgctatggtcttcatggaactgagttggcttgtgaaaaggagtgtagcaggggagaagattatcgtctgatcaagcttgcaatcatagattacaataaaaagaaggagaaagttgttgttgtggagtgtagaggacatgatgctgctaggttgaatagcgtcgatcatgctcatggttgggagaaggatgtcgtagatatggttgatgaactgcatgggaaggacaagattctggtttcgttcaactgtgagacactgaaatctgacaaagcagcagaagatcatatcagcaagtttttgcccaaacttgctggcctagatgctgttgtgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

14.1

Weight (kDa)

5.96

Isoelectric Point (pI)

19.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 206, 296
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 297
AoxI GGCC 2 cut(s) 17, 365
ApeKI GCWGC 2 cut(s) 195, 324
BbsI GAAGAC 1 cut(s) 54
BbvI GCAGC 2 cut(s) 182, 336
BclI TGATCA 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 297
BfaI CTAG 2 cut(s) 199, 369
BisI GCNGC 2 cut(s) 196, 325
BlsI GCNGC 2 cut(s) 197, 326
BmsI GCATC 2 cut(s) 182, 362
BpiI GAAGAC 1 cut(s) 54
BseGI GGATG 1 cut(s) 245
BseMII CTCAG 1 cut(s) 64
BseXI GCAGC 2 cut(s) 182, 336
BshFI GGCC 2 cut(s) 19, 367
BsmAI GTCTC 1 cut(s) 297
BsnI GGCC 2 cut(s) 19, 367
Bsp143I GATC 3 cut(s) 121, 215, 332
BspANI GGCC 2 cut(s) 19, 367
BspCNI CTCAG 1 cut(s) 65
BssMI GATC 3 cut(s) 121, 215, 332
Bst4CI ACNGT 1 cut(s) 300
BstC8I GCNNGC 2 cut(s) 130, 365
BstDEI CTNAG 1 cut(s) 73
BstF5I GGATG 1 cut(s) 245
BstKTI GATC 3 cut(s) 124, 218, 335
BstMAI GTCTC 1 cut(s) 297
BstMBI GATC 3 cut(s) 121, 215, 332
BstV1I GCAGC 2 cut(s) 182, 336
BstV2I GAAGAC 1 cut(s) 54
BsuRI GGCC 2 cut(s) 19, 367
BtsCI GGATG 1 cut(s) 245
BtsIMutI CAGTG 1 cut(s) 306
Cac8I GCNNGC 2 cut(s) 130, 365
CseI GACGC 1 cut(s) 200
CviAII CATG 5 cut(s) 66, 189, 219, 225, 267
CviJI RGCY 4 cut(s) 19, 81, 128, 367
CviKI_1 RGCY 4 cut(s) 19, 81, 128, 367
DdeI CTNAG 1 cut(s) 73
DpnI GATC 3 cut(s) 123, 217, 334
DpnII GATC 3 cut(s) 121, 215, 332
FaeI CATG 5 cut(s) 69, 192, 222, 228, 270
FatI CATG 5 cut(s) 65, 188, 218, 224, 266
FbaI TGATCA 1 cut(s) 121
Fnu4HI GCNGC 2 cut(s) 196, 325
FokI GGATG 1 cut(s) 252
Fsp4HI GCNGC 2 cut(s) 196, 325
FspBI CTAG 2 cut(s) 199, 369
GluI GCNGC 2 cut(s) 196, 325
HaeIII GGCC 2 cut(s) 19, 367
HgaI GACGC 1 cut(s) 200
Hin1II CATG 5 cut(s) 69, 192, 222, 228, 270
HindIII AAGCTT 1 cut(s) 126
HinfI GANTC 2 cut(s) 39, 281
Hpy188I TCNGA 2 cut(s) 121, 317
Hpy99I CGWCG 1 cut(s) 216
HpyAV CCTTC 3 cut(s) 149, 230, 266
HpyCH4III ACNGT 1 cut(s) 300
HpyCH4V TGCA 2 cut(s) 132, 266
HpyF3I CTNAG 1 cut(s) 73
Hsp92II CATG 5 cut(s) 69, 192, 222, 228, 270
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 3 cut(s) 121, 215, 332
LpnPI CCDG 3 cut(s) 86, 270, 349
Lsp1109I GCAGC 2 cut(s) 182, 336
LweI GCATC 2 cut(s) 182, 362
MaeI CTAG 2 cut(s) 199, 369
MalI GATC 3 cut(s) 123, 217, 334
MboI GATC 3 cut(s) 121, 215, 332
MboII GAAGA 3 cut(s) 54, 120, 342
MnlI CCTC 1 cut(s) 177
MslI CAYNNNNRTG 2 cut(s) 30, 223
NdeII GATC 3 cut(s) 121, 215, 332
NlaIII CATG 5 cut(s) 69, 192, 222, 228, 270
PfeI GAWTC 2 cut(s) 39, 281
PkrI GCNGC 2 cut(s) 197, 326
RseI CAYNNNNRTG 2 cut(s) 30, 223
SatI GCNGC 2 cut(s) 196, 325
Sau3AI GATC 3 cut(s) 121, 215, 332
SetI ASST 2 cut(s) 130, 204
SfaNI GCATC 2 cut(s) 182, 362
SmiMI CAYNNNNRTG 2 cut(s) 30, 223
SspMI CTAG 2 cut(s) 199, 369
TaaI ACNGT 1 cut(s) 300
TaqI TCGA 1 cut(s) 214
TfiI GAWTC 2 cut(s) 39, 281
TscAI CASTG 1 cut(s) 313
TseI GCWGC 2 cut(s) 195, 324
TspDTI ATGAA 3 cut(s) 14, 54, 274
TspRI CASTG 1 cut(s) 313
XspI CTAG 2 cut(s) 199, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.