Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0012388.1

Orthogroup ID

OG0007432

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1946

Gene Structure 1946 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0012388.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 683 bp

atgagcttgccaagggcatcttgaggggagagtttaaagaagaagacatcattttggtcgacacagaggtcacggcgtttggcaatggccagctaccccagcaaaagctagtcttcaagacgcttgaaactggttctgaatctcctacagcggagaacaaagaagctttaagcaaatggataagtctctcttgtcaagctaacatcttttctatatattcctatttggatgaaggtggcgaagtggagtcaaaagtaggggaggtaatggaaggagtggcttcaatagcattgttaccatgtgggtctatatcaggccatttcatcaaagtgaatgattccaccaacatttgctatggtcttcatggaactgagttggcttgtgaaaaggagtgtagcaggggagaagattatcgtctgatcaagcttgcaatcatagactacaataaaaagaaggagaaagttgttgttgtggagtgcagaggccatgatgctgcgaggttaagtagcgttgatcatgctcatggttgggagaaggatgtcatagatatggttgatgaacagcatgggaaggacaagattgtggtttcgttcaactgtgagacactgaaatctgacaaagcagcagaagatcatatcagcaagtttttgcccaaactagctggcctagatgctgttgtgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

226

Amino Acids

24.8

Weight (kDa)

5.01

Isoelectric Point (pI)

26.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007432)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G29280 AT3G29280
fragaria_vesca	FvH4_6g47420
malus_domestica	MD09G1061600.v1.1
prunus_persica	Prupe.3G258600_v2.0.a1 Prupe.3G258600_v2.0.a1
pyrus_communis	pycom111g05190 pycom17g05580
rosa_chinensis	RchiOBHm_Chr2g0166491 RchiOBHm_Chr2g0166501
rosa_laevigata	RLG00000021623
rosa_multiflora	Rmu_co8408345.1_g000001 Rmu_sc0005109.1_g000001 Rmu_sc0012388.1_g000001
rosa_roxburghii	Rroxscaffold_2G00084830
rosa_rugosa	Rorug02G0523400 Rorug02G0523500 Rorug02G0523600 Rorug02G0523700
rosa_samantha	Rh2AG589500 Rh2BG601700 Rh2CG572300 Rh2CG572400 Rh2DG612300
rosa_wichuraiana	Rw2G049140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	67
AccI	GTMKAC	1 cut(s)	59
AciI	CCGC	1 cut(s)	151
AcoI	YGGCCR	1 cut(s)	87
AgsI	TTSAA	4 cut(s)	117, 127, 284, 594
AluBI	AGCT	7 cut(s)	6, 93, 108, 166, 199, 426, 661
AluI	AGCT	7 cut(s)	6, 93, 108, 166, 199, 426, 661
Alw26I	GTCTC	2 cut(s)	190, 595
AoxI	GGCC	4 cut(s)	87, 315, 483, 663
ApeKI	GCWGC	2 cut(s)	493, 622
BalI	TGGCCA	1 cut(s)	89
BbsI	GAAGAC	3 cut(s)	50, 105, 352
BbvI	GCAGC	2 cut(s)	480, 634
BceAI	ACGGC	1 cut(s)	89
BclI	TGATCA	2 cut(s)	419, 513
BcoDI	GTCTC	2 cut(s)	190, 595
BfaI	CTAG	3 cut(s)	109, 658, 667
BfmI	CTRYAG	1 cut(s)	146
BisI	GCNGC	2 cut(s)	494, 623
BlsI	GCNGC	2 cut(s)	495, 624
BmsI	GCATC	3 cut(s)	26, 480, 660
BpiI	GAAGAC	3 cut(s)	50, 105, 352
BpuEI	CTTGAG	1 cut(s)	42
BsaJI	CCNNGG	1 cut(s)	11
Bse1I	ACTGG	1 cut(s)	135
Bse3DI	GCAATG	1 cut(s)	90
BseDI	CCNNGG	1 cut(s)	11
BseGI	GGATG	2 cut(s)	234, 543
BseMI	GCAATG	1 cut(s)	90
BseMII	CTCAG	1 cut(s)	362
BseNI	ACTGG	1 cut(s)	135
BseXI	GCAGC	2 cut(s)	480, 634
BseYI	CCCAGC	1 cut(s)	98
BsgI	GTGCAG	1 cut(s)	498
BshFI	GGCC	4 cut(s)	89, 317, 485, 665
BsmAI	GTCTC	2 cut(s)	190, 595
BsnI	GGCC	4 cut(s)	89, 317, 485, 665
Bsp143I	GATC	3 cut(s)	419, 513, 630
BspACI	CCGC	1 cut(s)	151
BspANI	GGCC	4 cut(s)	89, 317, 485, 665
BspCNI	CTCAG	1 cut(s)	363
BsrDI	GCAATG	1 cut(s)	90
BsrI	ACTGG	1 cut(s)	135
BssECI	CCNNGG	1 cut(s)	11
BssMI	GATC	3 cut(s)	419, 513, 630
BssT1I	CCWWGG	1 cut(s)	11
Bst4CI	ACNGT	1 cut(s)	598
BstC8I	GCNNGC	4 cut(s)	8, 91, 428, 663
BstDEI	CTNAG	1 cut(s)	371
BstF5I	GGATG	2 cut(s)	234, 543
BstKTI	GATC	3 cut(s)	422, 516, 633
BstMAI	GTCTC	2 cut(s)	190, 595
BstMBI	GATC	3 cut(s)	419, 513, 630
BstMWI	GCNNNNNNNGC	2 cut(s)	99, 286
BstSFI	CTRYAG	1 cut(s)	146
BstV1I	GCAGC	2 cut(s)	480, 634
BstV2I	GAAGAC	3 cut(s)	50, 105, 352
BsuRI	GGCC	4 cut(s)	89, 317, 485, 665
BtsCI	GGATG	2 cut(s)	234, 543
BtsIMutI	CAGTG	1 cut(s)	604
Cac8I	GCNNGC	4 cut(s)	8, 91, 428, 663
CseI	GACGC	1 cut(s)	129
CviAII	CATG	6 cut(s)	299, 364, 487, 517, 523, 565
DdeI	CTNAG	1 cut(s)	371
DpnI	GATC	3 cut(s)	421, 515, 632
DpnII	GATC	3 cut(s)	419, 513, 630
DraI	TTTAAA	1 cut(s)	36
DrdI	GACNNNNNNGTC	1 cut(s)	67
DseDI	GACNNNNNNGTC	1 cut(s)	67
EaeI	YGGCCR	1 cut(s)	87
Eco130I	CCWWGG	1 cut(s)	11
EcoT14I	CCWWGG	1 cut(s)	11
ErhI	CCWWGG	1 cut(s)	11
FaeI	CATG	6 cut(s)	302, 367, 490, 520, 526, 568
FalI	AAGNNNNNCTT	5 cut(s)	36, 97, 129, 174, 206
FatI	CATG	6 cut(s)	298, 363, 486, 516, 522, 564
FbaI	TGATCA	2 cut(s)	419, 513
FblI	GTMKAC	1 cut(s)	59
Fnu4HI	GCNGC	2 cut(s)	494, 623
FokI	GGATG	2 cut(s)	241, 550
Fsp4HI	GCNGC	2 cut(s)	494, 623
FspBI	CTAG	3 cut(s)	109, 658, 667
GluI	GCNGC	2 cut(s)	494, 623
GsaI	CCCAGC	1 cut(s)	102
HaeIII	GGCC	4 cut(s)	89, 317, 485, 665
HgaI	GACGC	1 cut(s)	129
Hin1II	CATG	6 cut(s)	302, 367, 490, 520, 526, 568
HincII	GTYRAC	1 cut(s)	60
HindII	GTYRAC	1 cut(s)	60
HindIII	AAGCTT	2 cut(s)	164, 424
HinfI	GANTC	3 cut(s)	139, 247, 337
Hpy166II	GTNNAC	1 cut(s)	60
Hpy188I	TCNGA	3 cut(s)	138, 419, 615
Hpy188III	TCNNGA	2 cut(s)	21, 117
Hpy8I	GTNNAC	1 cut(s)	60
HpyAV	CCTTC	5 cut(s)	226, 265, 447, 528, 564
HpyCH4III	ACNGT	1 cut(s)	598
HpyCH4V	TGCA	2 cut(s)	430, 479
HpyF10VI	GCNNNNNNNGC	2 cut(s)	99, 286
HpyF3I	CTNAG	1 cut(s)	371
Hsp92II	CATG	6 cut(s)	302, 367, 490, 520, 526, 568
Ksp22I	TGATCA	2 cut(s)	419, 513
Kzo9I	GATC	3 cut(s)	419, 513, 630
LpnPI	CCDG	6 cut(s)	103, 112, 116, 299, 384, 647
Lsp1109I	GCAGC	2 cut(s)	480, 634
LweI	GCATC	3 cut(s)	26, 480, 660
MaeI	CTAG	3 cut(s)	109, 658, 667
MaeIII	GTNAC	2 cut(s)	69, 293
MalI	GATC	3 cut(s)	421, 515, 632
MboI	GATC	3 cut(s)	419, 513, 630
MboII	GAAGA	6 cut(s)	52, 55, 105, 352, 418, 640
MlsI	TGGCCA	1 cut(s)	89
MluNI	TGGCCA	1 cut(s)	89
MlyI	GAGTC	1 cut(s)	256
MnlI	CCTC	5 cut(s)	17, 60, 255, 475, 491
Mox20I	TGGCCA	1 cut(s)	89
MscI	TGGCCA	1 cut(s)	89
MseI	TTAA	3 cut(s)	35, 169, 502
MslI	CAYNNNNRTG	3 cut(s)	328, 521, 547
Msp20I	TGGCCA	1 cut(s)	89
MspA1I	CMGCKG	1 cut(s)	151
MwoI	GCNNNNNNNGC	2 cut(s)	99, 286
NdeII	GATC	3 cut(s)	419, 513, 630
NlaIII	CATG	6 cut(s)	302, 367, 490, 520, 526, 568
NmuCI	GTSAC	1 cut(s)	69
PfeI	GAWTC	2 cut(s)	139, 337
PkrI	GCNGC	2 cut(s)	495, 624
PleI	GAGTC	1 cut(s)	255
PpsI	GAGTC	1 cut(s)	255
PspFI	CCCAGC	1 cut(s)	98
RseI	CAYNNNNRTG	3 cut(s)	328, 521, 547
SalI	GTCGAC	1 cut(s)	58
SaqAI	TTAA	3 cut(s)	35, 169, 502
SatI	GCNGC	2 cut(s)	494, 623
Sau3AI	GATC	3 cut(s)	419, 513, 630
SchI	GAGTC	1 cut(s)	256
SfaNI	GCATC	3 cut(s)	26, 480, 660
SfcI	CTRYAG	1 cut(s)	146
SmiMI	CAYNNNNRTG	3 cut(s)	328, 521, 547
SmlI	CTYRAG	1 cut(s)	21
SmoI	CTYRAG	1 cut(s)	21
SsiI	CCGC	1 cut(s)	151
SspMI	CTAG	3 cut(s)	109, 658, 667
StyI	CCWWGG	1 cut(s)	11
TaaI	ACNGT	1 cut(s)	598
TaqI	TCGA	1 cut(s)	59
TfiI	GAWTC	2 cut(s)	139, 337
Tru1I	TTAA	3 cut(s)	35, 169, 502
Tru9I	TTAA	3 cut(s)	35, 169, 502
TscAI	CASTG	1 cut(s)	611
TseFI	GTSAC	1 cut(s)	69
TseI	GCWGC	2 cut(s)	493, 622
Tsp45I	GTSAC	1 cut(s)	69
TspDTI	ATGAA	4 cut(s)	245, 312, 352, 572
TspRI	CASTG	1 cut(s)	611
XmiI	GTMKAC	1 cut(s)	59
XspI	CTAG	3 cut(s)	109, 658, 667

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.