Rorug02G0523400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0007432
Physical Location & Seq
Reverse (-)
65436784 .. 65437289
506 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0523400.1

Sequence Viewer

Length: 354 bp
ATGCATTTCAAGATTCAATTCTTAAACCTTGGAGGTTGTGAGGCACTTGAGGAGCTACCCAAAGACATAGGGAACTTGATCAACCTCAGATTCTTGACCTTAACTACACAGCAGGTGTATTTGCCGAAAGGAGTATTTAGACGCCTCACCTTACTTCAATCTTTACGCATTGGAAATTGTGAGAGTCTAAAATCTTTAGGCAAAGAATTTGAATACCTCACTAGCCTTCGTCAACTGCGGATTGGTTATTGTGGAAACCTGGAGTCCTTGCCACCTAACATGAATAAATTGACGGCATTACATACTTTTGCGATATTAGATTGTGTAAAGCTTGAGCTAATGAGGTGGGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

117

Amino Acids

13.41

Weight (kDa)

9.02

Isoelectric Point (pI)

44.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 7 - 105 3.8e-10 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 103
Acc36I ACCTGC 1 cut(s) 103
AciI CCGC 1 cut(s) 238
AcsI RAATTY 1 cut(s) 206
AcyI GRCGYC 1 cut(s) 142
AgsI TTSAA 4 cut(s) 10, 17, 158, 212
AjnI CCWGG 1 cut(s) 258
AluBI AGCT 3 cut(s) 55, 331, 337
AluI AGCT 3 cut(s) 55, 331, 337
ApoI RAATTY 1 cut(s) 206
AsuHPI GGTGA 1 cut(s) 139
BceAI ACGGC 1 cut(s) 309
BciT130I CCWGG 1 cut(s) 260
BclI TGATCA 1 cut(s) 78
BfaI CTAG 1 cut(s) 222
BfuAI ACCTGC 1 cut(s) 103
Bme1390I CCNGG 1 cut(s) 260
BmrFI CCNGG 1 cut(s) 260
BpmI CTGGAG 1 cut(s) 281
BpuEI CTTGAG 2 cut(s) 68, 353
BsaHI GRCGYC 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 260
BseDI CCNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 65
Bsp143I GATC 1 cut(s) 78
BspACI CCGC 1 cut(s) 238
BspCNI CTCAG 1 cut(s) 99
BspMI ACCTGC 1 cut(s) 103
BssECI CCNNGG 1 cut(s) 28
BssMI GATC 1 cut(s) 78
BssNI GRCGYC 1 cut(s) 142
BssT1I CCWWGG 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 260
BstACI GRCGYC 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 86
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNI CCWGG 1 cut(s) 260
BstSCI CCNGG 1 cut(s) 258
BveI ACCTGC 1 cut(s) 103
CseI GACGC 1 cut(s) 150
CviAII CATG 1 cut(s) 280
CviJI RGCY 4 cut(s) 55, 225, 331, 337
CviKI_1 RGCY 4 cut(s) 55, 225, 331, 337
DdeI CTNAG 1 cut(s) 86
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
Eco130I CCWWGG 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 28
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 28
FaeI CATG 1 cut(s) 283
FaiI YATR 3 cut(s) 68, 281, 303
FatI CATG 1 cut(s) 279
FbaI TGATCA 1 cut(s) 78
FspBI CTAG 1 cut(s) 222
GsuI CTGGAG 1 cut(s) 281
HgaI GACGC 1 cut(s) 150
Hin1I GRCGYC 1 cut(s) 142
Hin1II CATG 1 cut(s) 283
HincII GTYRAC 1 cut(s) 233
HindII GTYRAC 1 cut(s) 233
HindIII AAGCTT 1 cut(s) 329
HinfI GANTC 4 cut(s) 13, 90, 184, 263
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 1 cut(s) 89
Hpy188III TCNNGA 2 cut(s) 10, 94
Hpy8I GTNNAC 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 236
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 86
Hsp92I GRCGYC 1 cut(s) 142
Hsp92II CATG 1 cut(s) 283
Ksp22I TGATCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 78
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 3 cut(s) 98, 245, 272
MaeI CTAG 1 cut(s) 222
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MluCI AATT 4 cut(s) 17, 175, 206, 287
MlyI GAGTC 2 cut(s) 193, 272
MnlI CCTC 7 cut(s) 26, 34, 43, 95, 155, 227, 336
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 23, 101
MspR9I CCNGG 1 cut(s) 260
MvaI CCWGG 1 cut(s) 260
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 283
NsiI ATGCAT 1 cut(s) 6
PaqCI CACCTGC 1 cut(s) 103
PfeI GAWTC 2 cut(s) 13, 90
PleI GAGTC 2 cut(s) 192, 271
PpsI GAGTC 2 cut(s) 192, 271
Psp6I CCWGG 1 cut(s) 258
PspGI CCWGG 1 cut(s) 258
SaqAI TTAA 2 cut(s) 23, 101
Sau3AI GATC 1 cut(s) 78
SchI GAGTC 2 cut(s) 193, 272
ScrFI CCNGG 1 cut(s) 260
SmlI CTYRAG 2 cut(s) 47, 332
SmoI CTYRAG 2 cut(s) 47, 332
Sse9I AATT 4 cut(s) 17, 175, 206, 287
SsiI CCGC 1 cut(s) 238
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 258
StyI CCWWGG 1 cut(s) 28
TasI AATT 4 cut(s) 17, 175, 206, 287
TfiI GAWTC 2 cut(s) 13, 90
Tru1I TTAA 2 cut(s) 23, 101
Tru9I TTAA 2 cut(s) 23, 101
TspDTI ATGAA 1 cut(s) 296
XapI RAATTY 1 cut(s) 206
XspI CTAG 1 cut(s) 222
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.