Rmu_co8424235.1_g000001

Protein DYAD-like isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8424235.1
Physical Location & Seq
Reverse (-)
58 .. 839
782 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8424235.1_g000001.1.cds

Sequence Viewer

Length: 702 bp
atggcacagtggggtgttcgtcggagagttgtgttccttaaagaaaataatcctcaagttgcatccagcatcactaaggaagaaaaggtagaagattccaaagatgaagttgtaagagctgtggtagaggattcaaaagacgaagttttaagagctgtgaaaactgaacctctagagatgccagaacccaaaaggaggaagtgccttgaccgcagatctaaagatgtgcaggcagcattgcgtgctaagaaaaggcaacatgggtttaggccaatggagagaaatgagatcataggaggaagatggaatgttgagaggtataagaaagcagagcaaagtctgttggatgttttggaggctaaagaggcaacttttgccaacccagttagcaggacagatctgagattgacagctcgaggaaaaattggtgacactggactgattgaccacctactgaagcacattgatggcacagttacaccatgtgggagcaagcggtttcggcggtggttcaaccacaatggaataatggaatattggttggagagtgcggaactggctgacattcggaaagaggctgggcatcatccttattggtttccaccaggttgtggtgcctctgagcattatgattcttctggagaactgaggctactcaaggcagaagtggataaaatgaaaaggtggatatatacttcataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

233

Amino Acids

26.98

Weight (kDa)

9.36

Isoelectric Point (pI)

62.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 614
AccB7I CCANNNNNTGG 1 cut(s) 611
AciI CCGC 4 cut(s) 211, 496, 505, 551
AcuI CTGAAG 1 cut(s) 476
AdeI CACNNNGTG 1 cut(s) 485
AfiI CCNNNNNNNGG 2 cut(s) 195, 611
AgsI TTSAA 2 cut(s) 135, 514
AjnI CCWGG 1 cut(s) 604
AluBI AGCT 3 cut(s) 119, 155, 413
AluI AGCT 3 cut(s) 119, 155, 413
Ama87I CYCGRG 1 cut(s) 414
AoxI GGCC 1 cut(s) 269
ApeKI GCWGC 1 cut(s) 233
AsuHPI GGTGA 1 cut(s) 440
AvaI CYCGRG 1 cut(s) 414
BanI GGYRCC 1 cut(s) 614
BbvI GCAGC 1 cut(s) 245
BccI CCATC 2 cut(s) 297, 461
BciT130I CCWGG 1 cut(s) 606
BfaI CTAG 1 cut(s) 173
BglII AGATCT 2 cut(s) 215, 397
BisI GCNGC 1 cut(s) 234
BlsI GCNGC 1 cut(s) 235
Bme1390I CCNGG 1 cut(s) 606
BmeT110I CYCGRG 1 cut(s) 414
BmiI GGNNCC 1 cut(s) 616
BmrFI CCNGG 1 cut(s) 606
BmrI ACTGGG 1 cut(s) 377
BmsI GCATC 4 cut(s) 71, 78, 168, 592
BmuI ACTGGG 1 cut(s) 377
BpmI CTGGAG 1 cut(s) 660
BpuEI CTTGAG 2 cut(s) 39, 641
Bsc4I CCNNNNNNNGG 2 cut(s) 195, 611
Bse1I ACTGG 3 cut(s) 383, 439, 561
Bse3DI GCAATG 1 cut(s) 236
BseBI CCWGG 1 cut(s) 606
BseGI GGATG 3 cut(s) 62, 352, 586
BseLI CCNNNNNNNGG 2 cut(s) 195, 611
BseMI GCAATG 1 cut(s) 236
BseMII CTCAG 3 cut(s) 392, 612, 638
BseNI ACTGG 3 cut(s) 383, 439, 561
BseXI GCAGC 1 cut(s) 245
BseYI CCCAGC 1 cut(s) 578
BsgI GTGCAG 1 cut(s) 248
BshFI GGCC 1 cut(s) 271
BshNI GGYRCC 1 cut(s) 614
BsiHKCI CYCGRG 1 cut(s) 414
BslI CCNNNNNNNGG 2 cut(s) 195, 611
BsnI GGCC 1 cut(s) 271
BsoBI CYCGRG 1 cut(s) 414
Bsp143I GATC 3 cut(s) 215, 288, 397
BspACI CCGC 4 cut(s) 211, 496, 505, 551
BspANI GGCC 1 cut(s) 271
BspCNI CTCAG 3 cut(s) 393, 613, 639
BspLI GGNNCC 1 cut(s) 616
BspT107I GGYRCC 1 cut(s) 614
BsrDI GCAATG 1 cut(s) 236
BsrI ACTGG 3 cut(s) 383, 439, 561
BssMI GATC 3 cut(s) 215, 288, 397
Bst2UI CCWGG 1 cut(s) 606
Bst4CI ACNGT 2 cut(s) 9, 475
BstAPI GCANNNNNTGC 2 cut(s) 242, 374
BstC8I GCNNGC 3 cut(s) 231, 243, 494
BstDEI CTNAG 5 cut(s) 75, 246, 401, 621, 647
BstF5I GGATG 3 cut(s) 62, 352, 586
BstKTI GATC 3 cut(s) 218, 291, 400
BstMBI GATC 3 cut(s) 215, 288, 397
BstMWI GCNNNNNNNGC 6 cut(s) 210, 242, 365, 374, 502, 557
BstNI CCWGG 1 cut(s) 606
BstSCI CCNGG 1 cut(s) 604
BstV1I GCAGC 1 cut(s) 245
BstX2I RGATCY 2 cut(s) 215, 397
BstYI RGATCY 2 cut(s) 215, 397
BsuRI GGCC 1 cut(s) 271
BtsCI GGATG 3 cut(s) 62, 352, 586
BtsIMutI CAGTG 2 cut(s) 14, 432
Cac8I GCNNGC 3 cut(s) 231, 243, 494
CsiI ACCWGGT 1 cut(s) 604
CviAII CATG 2 cut(s) 260, 483
CviJI RGCY 8 cut(s) 119, 155, 271, 359, 413, 560, 578, 652
CviKI_1 RGCY 8 cut(s) 119, 155, 271, 359, 413, 560, 578, 652
DdeI CTNAG 5 cut(s) 75, 246, 401, 621, 647
DpnI GATC 3 cut(s) 217, 290, 399
DpnII GATC 3 cut(s) 215, 288, 397
DraIII CACNNNGTG 1 cut(s) 485
Eco57I CTGAAG 1 cut(s) 476
Eco88I CYCGRG 1 cut(s) 414
EcoRII CCWGG 1 cut(s) 604
FaeI CATG 2 cut(s) 263, 486
FaiI YATR 8 cut(s) 261, 293, 321, 484, 630, 691, 693, 700
FatI CATG 2 cut(s) 259, 482
Fnu4HI GCNGC 1 cut(s) 234
FokI GGATG 3 cut(s) 49, 359, 573
Fsp4HI GCNGC 1 cut(s) 234
FspBI CTAG 1 cut(s) 173
GluI GCNGC 1 cut(s) 234
GsaI CCCAGC 1 cut(s) 582
GsuI CTGGAG 1 cut(s) 660
HaeIII GGCC 1 cut(s) 271
Hin1II CATG 2 cut(s) 263, 486
HinfI GANTC 3 cut(s) 95, 131, 632
HphI GGTGA 1 cut(s) 440
Hpy188I TCNGA 4 cut(s) 24, 402, 570, 622
Hpy188III TCNNGA 2 cut(s) 173, 639
Hpy99I CGWCG 1 cut(s) 24
HpyCH4III ACNGT 2 cut(s) 9, 475
HpyCH4V TGCA 2 cut(s) 62, 229
HpyF10VI GCNNNNNNNGC 6 cut(s) 210, 242, 365, 374, 502, 557
HpyF3I CTNAG 5 cut(s) 75, 246, 401, 621, 647
Hsp92II CATG 2 cut(s) 263, 486
Kzo9I GATC 3 cut(s) 215, 288, 397
LmnI GCTCC 1 cut(s) 489
Lsp1109I GCAGC 1 cut(s) 245
LweI GCATC 4 cut(s) 71, 78, 168, 592
MabI ACCWGGT 1 cut(s) 604
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 2 cut(s) 428, 475
MalI GATC 3 cut(s) 217, 290, 399
MboI GATC 3 cut(s) 215, 288, 397
MboII GAAGA 4 cut(s) 92, 104, 312, 627
MflI RGATCY 2 cut(s) 215, 397
MluCI AATT 1 cut(s) 423
MmeI TCCRAC 2 cut(s) 324, 522
MseI TTAA 2 cut(s) 39, 149
MslI CAYNNNNRTG 1 cut(s) 465
MspR9I CCNGG 1 cut(s) 606
MvaI CCWGG 1 cut(s) 606
MwoI GCNNNNNNNGC 6 cut(s) 210, 242, 365, 374, 502, 557
NdeII GATC 3 cut(s) 215, 288, 397
NlaIII CATG 2 cut(s) 263, 486
NlaIV GGNNCC 1 cut(s) 616
NmuCI GTSAC 1 cut(s) 428
PaeR7I CTCGAG 1 cut(s) 414
PfeI GAWTC 3 cut(s) 95, 131, 632
PflMI CCANNNNNTGG 1 cut(s) 611
PkrI GCNGC 1 cut(s) 235
Psp6I CCWGG 1 cut(s) 604
PspFI CCCAGC 1 cut(s) 578
PspGI CCWGG 1 cut(s) 604
PspN4I GGNNCC 1 cut(s) 616
PspXI VCTCGAGB 1 cut(s) 414
PsrI GAACNNNNNNTAC 2 cut(s) 636, 668
PsuI RGATCY 2 cut(s) 215, 397
RseI CAYNNNNRTG 1 cut(s) 465
SaqAI TTAA 2 cut(s) 39, 149
SatI GCNGC 1 cut(s) 234
Sau3AI GATC 3 cut(s) 215, 288, 397
ScrFI CCNGG 1 cut(s) 606
SetI ASST 9 cut(s) 90, 121, 157, 172, 320, 415, 453, 610, 686
SexAI ACCWGGT 1 cut(s) 604
SfaNI GCATC 4 cut(s) 71, 78, 168, 592
Sfr274I CTCGAG 1 cut(s) 414
SlaI CTCGAG 1 cut(s) 414
SmiMI CAYNNNNRTG 1 cut(s) 465
SmlI CTYRAG 3 cut(s) 54, 414, 656
SmoI CTYRAG 3 cut(s) 54, 414, 656
Sse9I AATT 1 cut(s) 423
SsiI CCGC 4 cut(s) 211, 496, 505, 551
SspI AATATT 1 cut(s) 536
SspMI CTAG 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 604
TaaI ACNGT 2 cut(s) 9, 475
TaqI TCGA 1 cut(s) 415
TasI AATT 1 cut(s) 423
TfiI GAWTC 3 cut(s) 95, 131, 632
Tru1I TTAA 2 cut(s) 39, 149
Tru9I TTAA 2 cut(s) 39, 149
TscAI CASTG 2 cut(s) 14, 439
TseFI GTSAC 1 cut(s) 428
TseI GCWGC 1 cut(s) 233
Tsp45I GTSAC 1 cut(s) 428
TspDTI ATGAA 3 cut(s) 120, 687, 692
TspRI CASTG 2 cut(s) 14, 439
Van91I CCANNNNNTGG 1 cut(s) 611
XbaI TCTAGA 1 cut(s) 172
XhoI CTCGAG 1 cut(s) 414
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.