Rmu_co8442849.1_g000001

phenylalanine--tRNA ligase alpha

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8442849.1
Physical Location & Seq
Forward (+)
1 .. 1315
1315 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8442849.1_g000001.1.cds

Sequence Viewer

Length: 380 bp
ccaattttcaggtacggaagcaattgaaggacattttccttcaaatggggtttggagagatgcccactaataactatgtcgagagcagcttctggaactttgatgctcttttccagccacaacaacaccctgctcgtgattcacatgatacattcttcctgaaagttccttcaactactaaggaacttcctgaagattatgttgagagggtgaagcgtatacacgagtctggtggtcatcagtccaggggttatggatatgattggaaaagagaggaagctgataagaatcttctgcggactcacacaactgctgtttcctccaggatgctttacaagctagcacagcctttttattcatgtaatgctaccttggtttaa

Protein Analysis

125

Amino Acids

14.7

Weight (kDa)

8.06

Isoelectric Point (pI)

56.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 219
AciI CCGC 1 cut(s) 297
AcuI CTGAAG 1 cut(s) 212
AfaI GTAC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 3 cut(s) 27, 43, 173
AjnI CCWGG 2 cut(s) 244, 322
AluBI AGCT 3 cut(s) 89, 280, 339
AluI AGCT 3 cut(s) 89, 280, 339
AlwNI CAGNNNCTG 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 222
AsuNHI GCTAGC 1 cut(s) 339
BauI CACGAG 2 cut(s) 134, 223
BbvI GCAGC 1 cut(s) 98
BciT130I CCWGG 2 cut(s) 246, 324
BfaI CTAG 1 cut(s) 340
BisI GCNGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 88
Bme1390I CCNGG 2 cut(s) 246, 324
BmrFI CCNGG 2 cut(s) 246, 324
BmsI GCATC 3 cut(s) 50, 93, 317
BmtI GCTAGC 1 cut(s) 343
BpmI CTGGAG 1 cut(s) 306
BsaBI GATNNNNATC 1 cut(s) 287
BsaJI CCNNGG 2 cut(s) 245, 371
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse8I GATNNNNATC 1 cut(s) 287
BseBI CCWGG 2 cut(s) 246, 324
BseDI CCNNGG 2 cut(s) 245, 371
BseGI GGATG 1 cut(s) 332
BseJI GATNNNNATC 1 cut(s) 287
BseLI CCNNNNNNNGG 1 cut(s) 45
BseXI GCAGC 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 45
BspACI CCGC 1 cut(s) 297
BspOI GCTAGC 1 cut(s) 343
BssECI CCNNGG 2 cut(s) 245, 371
BssNAI GTATAC 1 cut(s) 220
BssSI CACGAG 2 cut(s) 134, 223
BssT1I CCWWGG 1 cut(s) 371
Bst1107I GTATAC 1 cut(s) 220
Bst2BI CACGAG 2 cut(s) 134, 223
Bst2UI CCWGG 2 cut(s) 246, 324
BstC8I GCNNGC 1 cut(s) 341
BstDEI CTNAG 1 cut(s) 179
BstF5I GGATG 1 cut(s) 332
BstMWI GCNNNNNNNGC 2 cut(s) 336, 345
BstNI CCWGG 2 cut(s) 246, 324
BstSCI CCNGG 2 cut(s) 244, 322
BstV1I GCAGC 1 cut(s) 98
BstZ17I GTATAC 1 cut(s) 220
BtsCI GGATG 1 cut(s) 332
Cac8I GCNNGC 1 cut(s) 341
CaiI CAGNNNCTG 1 cut(s) 92
Csp6I GTAC 1 cut(s) 13
CviAII CATG 2 cut(s) 145, 359
CviJI RGCY 5 cut(s) 89, 117, 280, 339, 348
CviKI_1 RGCY 5 cut(s) 89, 117, 280, 339, 348
CviQI GTAC 1 cut(s) 13
DdeI CTNAG 1 cut(s) 179
Eco130I CCWWGG 1 cut(s) 371
Eco57I CTGAAG 1 cut(s) 212
EcoRII CCWGG 2 cut(s) 244, 322
EcoT14I CCWWGG 1 cut(s) 371
ErhI CCWWGG 1 cut(s) 371
FaeI CATG 2 cut(s) 148, 362
FaiI YATR 7 cut(s) 77, 146, 200, 220, 254, 260, 360
FatI CATG 2 cut(s) 144, 358
FblI GTMKAC 1 cut(s) 219
Fnu4HI GCNGC 1 cut(s) 87
FokI GGATG 1 cut(s) 339
Fsp4HI GCNGC 1 cut(s) 87
FspBI CTAG 1 cut(s) 340
GluI GCNGC 1 cut(s) 87
GsuI CTGGAG 1 cut(s) 306
Hin1II CATG 2 cut(s) 148, 362
HinfI GANTC 4 cut(s) 139, 226, 288, 300
HphI GGTGA 1 cut(s) 222
Hpy166II GTNNAC 1 cut(s) 220
Hpy188III TCNNGA 5 cut(s) 81, 93, 136, 159, 190
Hpy8I GTNNAC 1 cut(s) 220
HpyAV CCTTC 3 cut(s) 21, 49, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 336, 345
HpyF3I CTNAG 1 cut(s) 179
Hsp92II CATG 2 cut(s) 148, 362
Lsp1109I GCAGC 1 cut(s) 98
LweI GCATC 3 cut(s) 50, 93, 317
MaeI CTAG 1 cut(s) 340
MboII GAAGA 3 cut(s) 147, 205, 283
MfeI CAATTG 1 cut(s) 22
MluCI AATT 2 cut(s) 3, 22
MlyI GAGTC 2 cut(s) 235, 294
MnlI CCTC 3 cut(s) 200, 267, 330
MseI TTAA 1 cut(s) 378
MspR9I CCNGG 2 cut(s) 246, 324
MunI CAATTG 1 cut(s) 22
MvaI CCWGG 2 cut(s) 246, 324
MwoI GCNNNNNNNGC 2 cut(s) 336, 345
NheI GCTAGC 1 cut(s) 339
NlaIII CATG 2 cut(s) 148, 362
PfeI GAWTC 2 cut(s) 139, 288
PfoI TCCNGGA 1 cut(s) 322
PkrI GCNGC 1 cut(s) 88
PleI GAGTC 2 cut(s) 234, 294
PpsI GAGTC 2 cut(s) 234, 294
Psp6I CCWGG 2 cut(s) 244, 322
PspGI CCWGG 2 cut(s) 244, 322
PstNI CAGNNNCTG 1 cut(s) 92
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
SaqAI TTAA 1 cut(s) 378
SatI GCNGC 1 cut(s) 87
SchI GAGTC 2 cut(s) 235, 294
ScrFI CCNGG 2 cut(s) 246, 324
SetI ASST 5 cut(s) 14, 91, 282, 341, 373
SfaNI GCATC 3 cut(s) 50, 93, 317
Sse9I AATT 2 cut(s) 3, 22
SsiI CCGC 1 cut(s) 297
SspMI CTAG 1 cut(s) 340
StyD4I CCNGG 2 cut(s) 244, 322
StyI CCWWGG 1 cut(s) 371
TaqI TCGA 1 cut(s) 80
TasI AATT 2 cut(s) 3, 22
TfiI GAWTC 2 cut(s) 139, 288
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TseI GCWGC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 347
TspGWI ACGGA 1 cut(s) 30
XmiI GTMKAC 1 cut(s) 219
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.