Rmu_co8456101.1_g000001

Nucleolar MIF4G domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8456101.1
Physical Location & Seq
Reverse (-)
2 .. 714
713 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8456101.1_g000001.1.cds

Sequence Viewer

Length: 419 bp
atggagaaatcaagacaagaaaagcgaaaagaagctcggtcggccaaaaatgccagaaaaaacgagtcttggctccaaagacagaaatctcaaaagctcaaaagctcaaaatctacagagaaacgacaaaattcttctgttcagaatgtgaaagacgaaacagttacccaattggatgctacttctgggagaagtaggaatatgaaaaaaactagtatgggagtggaaaaagaagttgaaaatactaaatcaaaggcgatgcgaggagacaaggtatcaaagagaaccccaaaaacaaagtttgagaagtttcttgaactggataatactagggctgaggaggatttggaactagaaaggaaacttgcaaagaaactcaaagtgaagggtggaaaattgaagggtgaggatcttggtct

Protein Analysis

140

Amino Acids

16.11

Weight (kDa)

10.18

Isoelectric Point (pI)

36.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 417
AcoI YGGCCR 1 cut(s) 42
AcsI RAATTY 1 cut(s) 130
AgsI TTSAA 3 cut(s) 239, 317, 400
AhlI ACTAGT 1 cut(s) 212
AluBI AGCT 3 cut(s) 35, 97, 105
AluI AGCT 3 cut(s) 35, 97, 105
Alw26I GTCTC 1 cut(s) 261
AlwI GGATC 1 cut(s) 417
AoxI GGCC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 130
AsuHPI GGTGA 1 cut(s) 416
BbvCI CCTCAGC 1 cut(s) 336
BcoDI GTCTC 1 cut(s) 261
BcuI ACTAGT 1 cut(s) 212
BfaI CTAG 3 cut(s) 213, 330, 353
BfmI CTRYAG 1 cut(s) 114
BmiI GGNNCC 1 cut(s) 74
BmsI GCATC 2 cut(s) 166, 249
Bpu10I CCTNAGC 1 cut(s) 336
BsaXI ACNNNNNCTCC 2 cut(s) 258, 288
Bse1I ACTGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 181
BseMII CTCAG 1 cut(s) 327
BseNI ACTGG 1 cut(s) 324
BseRI GAGGAG 2 cut(s) 279, 353
Bsh1285I CGRYCG 1 cut(s) 41
BshFI GGCC 1 cut(s) 44
BsiEI CGRYCG 1 cut(s) 41
BsmAI GTCTC 1 cut(s) 261
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 409
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 328
BspLI GGNNCC 1 cut(s) 74
BspPI GGATC 1 cut(s) 417
BsrI ACTGG 1 cut(s) 324
BssMI GATC 1 cut(s) 409
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 336
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 1 cut(s) 412
BstMAI GTCTC 1 cut(s) 261
BstMBI GATC 1 cut(s) 409
BstMCI CGRYCG 1 cut(s) 41
BstMWI GCNNNNNNNGC 2 cut(s) 41, 50
BstSFI CTRYAG 1 cut(s) 114
BstX2I RGATCY 1 cut(s) 409
BstYI RGATCY 1 cut(s) 409
BsuRI GGCC 1 cut(s) 44
BtgZI GCGATG 1 cut(s) 272
BtsCI GGATG 1 cut(s) 181
CviJI RGCY 6 cut(s) 35, 44, 73, 97, 105, 335
CviKI_1 RGCY 6 cut(s) 35, 44, 73, 97, 105, 335
DdeI CTNAG 1 cut(s) 336
DpnI GATC 1 cut(s) 411
DpnII GATC 1 cut(s) 409
EaeI YGGCCR 1 cut(s) 42
FaiI YATR 2 cut(s) 203, 218
FokI GGATG 1 cut(s) 188
FspBI CTAG 3 cut(s) 213, 330, 353
HaeIII GGCC 1 cut(s) 44
HinfI GANTC 1 cut(s) 65
HphI GGTGA 1 cut(s) 416
Hpy188I TCNGA 1 cut(s) 144
Hpy188III TCNNGA 2 cut(s) 12, 314
HpyAV CCTTC 2 cut(s) 379, 394
HpyCH4III ACNGT 1 cut(s) 163
HpyCH4V TGCA 1 cut(s) 368
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 50
HpyF3I CTNAG 1 cut(s) 336
Kzo9I GATC 1 cut(s) 409
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 3 cut(s) 67, 171, 305
LweI GCATC 2 cut(s) 166, 249
MaeI CTAG 3 cut(s) 213, 330, 353
MaeIII GTNAC 1 cut(s) 163
MalI GATC 1 cut(s) 411
MboI GATC 1 cut(s) 409
MboII GAAGA 1 cut(s) 126
MfeI CAATTG 1 cut(s) 170
MflI RGATCY 1 cut(s) 409
MluCI AATT 3 cut(s) 130, 170, 395
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 4 cut(s) 257, 331, 334, 400
MunI CAATTG 1 cut(s) 170
MwoI GCNNNNNNNGC 2 cut(s) 41, 50
NdeII GATC 1 cut(s) 409
NlaIV GGNNCC 1 cut(s) 74
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PspN4I GGNNCC 1 cut(s) 74
PsuI RGATCY 1 cut(s) 409
Sau3AI GATC 1 cut(s) 409
SchI GAGTC 1 cut(s) 74
SetI ASST 4 cut(s) 37, 99, 107, 276
SfaNI GCATC 2 cut(s) 166, 249
SfcI CTRYAG 1 cut(s) 114
SpeI ACTAGT 1 cut(s) 212
Sse9I AATT 3 cut(s) 130, 170, 395
SspMI CTAG 3 cut(s) 213, 330, 353
TaaI ACNGT 1 cut(s) 163
TaqII GACCGA 1 cut(s) 27
TasI AATT 3 cut(s) 130, 170, 395
TspDTI ATGAA 1 cut(s) 218
XapI RAATTY 1 cut(s) 130
XspI CTAG 3 cut(s) 213, 330, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.