Rmu_co8462439.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8462439.1
Physical Location & Seq
Forward (+)
129 .. 1630
1502 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8462439.1_g000001.1.cds

Sequence Viewer

Length: 1044 bp
atgaggactgatgactttgagaaaccaatgaagacaaatgtcatgtgtagcaactggaggagatggaagcaacctattatatggttccaaggtacaaatgacgctgtggcagcccagtttttcttgaagaatatacatccagagatgaggaaggctgcttctaatttatttggaaagccagaggctctccattctcggcctaatgtatttggagagctgatgagagtgcttatatctccttctgaagatgttgagcaagcaatcaattgggttatcggtggagtggatcctgatatttctctgcacatgcgaatgctcatgaataggtcggtgagagctgcacaggcagcactaaactgcatcagaaaagctgtgcgcaatcttggtaaagcctcaaggcccagggtggtcttagtgtcagataccccctctcttataaaaagtattacaccgaatataagcaagtttgctgaggtaattcattttgattacgaacttttcaaaggaaatatatctgacggcggtaaaagattgcgaagtttagaatttagagcaaaagattggggcccagcacccagatgggtcgcctttgtggacttctttcttgcatcacgggcaaaacatgctgttgtgtctggtgctcacaggcgtgttgggactacatatgctcagttaattgcagcactggctgcagcaaacaatctaggggacagtccaactggttcgaatttttcgttcttaagcagctttcaaagtgatttgttgagagaaggtttaagatttcagattggttggggacatgtgtggaacagatttgcaggtccccttagttgtcacaaccagcataaccaatgtgctttcacaccacttctccctcctgcatggtgggatggtctttggcaatctccactaacaagggatattaataggttggcagactacggcatccagttaactggttttggcaccattgatgaaacacatcttcagtctttttgtagctcaaagaaagttgctgtgaaaactattccgtacatattgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

347

Amino Acids

39.03

Weight (kDa)

9.83

Isoelectric Point (pI)

40.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 437
Acc16I TGCGCA 1 cut(s) 377
Acc36I ACCTGC 1 cut(s) 809
AccB1I GGYRCC 1 cut(s) 965
AciI CCGC 1 cut(s) 522
AclWI GGATC 2 cut(s) 281, 294
AcsI RAATTY 2 cut(s) 545, 727
AcuI CTGAAG 2 cut(s) 264, 971
AfaI GTAC 2 cut(s) 94, 1034
AflII CTTAAG 1 cut(s) 739
AflIII ACRYGT 1 cut(s) 799
AgsI TTSAA 3 cut(s) 127, 502, 752
AjnI CCWGG 1 cut(s) 401
AleI CACNNNNGTG 1 cut(s) 648
AluBI AGCT 5 cut(s) 217, 338, 371, 747, 1002
AluI AGCT 5 cut(s) 217, 338, 371, 747, 1002
Alw21I GWGCWC 1 cut(s) 643
AlwI GGATC 2 cut(s) 281, 294
AoxI GGCC 3 cut(s) 197, 398, 565
ApaI GGGCCC 1 cut(s) 569
ApeKI GCWGC 8 cut(s) 110, 155, 338, 347, 680, 689, 692, 744
ApoI RAATTY 2 cut(s) 545, 727
AseI ATTAAT 1 cut(s) 924
AspLEI GCGC 1 cut(s) 378
AspS9I GGNCC 4 cut(s) 399, 565, 566, 821
AsuHPI GGTGA 1 cut(s) 343
AsuII TTCGAA 1 cut(s) 725
AvaII GGWCC 1 cut(s) 821
BaeGI GKGCMC 1 cut(s) 569
BamHI GGATCC 1 cut(s) 286
BanI GGYRCC 1 cut(s) 965
BanII GRGCYC 1 cut(s) 569
BbsI GAAGAC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 643
BbvCI CCTCAGC 1 cut(s) 471
BbvI GCAGC 8 cut(s) 122, 142, 325, 359, 676, 692, 704, 756
BccI CCATC 3 cut(s) 57, 573, 884
BceAI ACGGC 2 cut(s) 535, 958
BciT130I CCWGG 1 cut(s) 403
BfaI CTAG 1 cut(s) 704
BfmI CTRYAG 1 cut(s) 690
BfrI CTTAAG 1 cut(s) 739
BfuAI ACCTGC 1 cut(s) 809
BisI GCNGC 8 cut(s) 111, 156, 339, 348, 681, 690, 693, 745
BlsI GCNGC 8 cut(s) 112, 157, 340, 349, 682, 691, 694, 746
Bme1390I CCNGG 1 cut(s) 403
Bme18I GGWCC 1 cut(s) 821
BmgT120I GGNCC 4 cut(s) 399, 565, 566, 821
BmiI GGNNCC 6 cut(s) 86, 288, 566, 567, 823, 967
BmrFI CCNGG 1 cut(s) 403
BmrI ACTGGG 1 cut(s) 109
BmsI GCATC 3 cut(s) 369, 617, 954
BmuI ACTGGG 1 cut(s) 109
BoxI GACNNNNGTC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 76
Bpu10I CCTNAGC 1 cut(s) 471
Bpu14I TTCGAA 1 cut(s) 725
BpuEI CTTGAG 1 cut(s) 379
BsaJI CCNNGG 3 cut(s) 88, 401, 402
BsaXI ACNNNNNCTCC 2 cut(s) 855, 885
Bse1I ACTGG 6 cut(s) 59, 115, 690, 724, 949, 961
BseBI CCWGG 1 cut(s) 403
BseDI CCNNGG 3 cut(s) 88, 401, 402
BseGI GGATG 3 cut(s) 136, 895, 945
BseMII CTCAG 2 cut(s) 462, 683
BseNI ACTGG 6 cut(s) 59, 115, 690, 724, 949, 961
BseRI GAGGAG 1 cut(s) 73
BseSI GKGCMC 1 cut(s) 569
BseXI GCAGC 8 cut(s) 122, 142, 325, 359, 676, 692, 704, 756
BseYI CCCAGC 1 cut(s) 568
BsgI GTGCAG 2 cut(s) 287, 324
BshFI GGCC 3 cut(s) 199, 400, 567
BshNI GGYRCC 1 cut(s) 965
BsiHKAI GWGCWC 1 cut(s) 643
BslFI GGGAC 4 cut(s) 670, 722, 807, 810
BsmFI GGGAC 4 cut(s) 670, 722, 807, 810
BsmI GAATGC 1 cut(s) 318
BsnI GGCC 3 cut(s) 199, 400, 567
Bsp119I TTCGAA 1 cut(s) 725
Bsp120I GGGCCC 1 cut(s) 565
Bsp1286I GDGCHC 2 cut(s) 569, 643
Bsp143I GATC 1 cut(s) 286
BspACI CCGC 1 cut(s) 522
BspANI GGCC 3 cut(s) 199, 400, 567
BspCNI CTCAG 2 cut(s) 463, 682
BspHI TCATGA 1 cut(s) 318
BspLI GGNNCC 6 cut(s) 86, 288, 566, 567, 823, 967
BspMAI CTGCAG 1 cut(s) 694
BspMI ACCTGC 1 cut(s) 809
BspPI GGATC 2 cut(s) 281, 294
BspT104I TTCGAA 1 cut(s) 725
BspT107I GGYRCC 1 cut(s) 965
BspTI CTTAAG 1 cut(s) 739
BsrI ACTGG 6 cut(s) 59, 115, 690, 724, 949, 961
BssECI CCNNGG 3 cut(s) 88, 401, 402
BssMI GATC 1 cut(s) 286
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 403
Bst4CI ACNGT 1 cut(s) 713
BstAFI CTTAAG 1 cut(s) 739
BstAPI GCANNNNNTGC 2 cut(s) 623, 689
BstBI TTCGAA 1 cut(s) 725
BstC8I GCNNGC 1 cut(s) 258
BstDEI CTNAG 4 cut(s) 412, 471, 669, 827
BstF5I GGATG 3 cut(s) 136, 895, 945
BstHHI GCGC 1 cut(s) 378
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstMWI GCNNNNNNNGC 7 cut(s) 110, 344, 347, 614, 623, 686, 689
BstNI CCWGG 1 cut(s) 403
BstNSI RCATGY 3 cut(s) 310, 626, 803
BstPAI GACNNNNGTC 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 401
BstSFI CTRYAG 1 cut(s) 690
BstSLI GKGCMC 1 cut(s) 569
BstV1I GCAGC 8 cut(s) 122, 142, 325, 359, 676, 692, 704, 756
BstV2I GAAGAC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 286
BstXI CCANNNNNNTGG 1 cut(s) 956
BstYI RGATCY 1 cut(s) 286
BsuRI GGCC 3 cut(s) 199, 400, 567
BtsCI GGATG 3 cut(s) 136, 895, 945
BtsIMutI CAGTG 1 cut(s) 683
BveI ACCTGC 1 cut(s) 809
Cac8I GCNNGC 1 cut(s) 258
CciI TCATGA 1 cut(s) 318
CfoI GCGC 1 cut(s) 378
Cfr13I GGNCC 4 cut(s) 399, 565, 566, 821
CseI GACGC 1 cut(s) 110
Csp6I GTAC 2 cut(s) 93, 1033
CviAII CATG 6 cut(s) 43, 307, 319, 623, 800, 882
CviQI GTAC 2 cut(s) 93, 1033
DdeI CTNAG 4 cut(s) 412, 471, 669, 827
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
Eco130I CCWWGG 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 569
Eco47I GGWCC 1 cut(s) 821
Eco57I CTGAAG 2 cut(s) 264, 971
EcoO109I RGGNCCY 2 cut(s) 565, 821
EcoRII CCWGG 1 cut(s) 401
EcoT14I CCWWGG 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 569
ErhI CCWWGG 1 cut(s) 88
FaeI CATG 6 cut(s) 46, 310, 322, 626, 803, 885
FaqI GGGAC 4 cut(s) 670, 722, 807, 810
FatI CATG 6 cut(s) 42, 306, 318, 622, 799, 881
FauNDI CATATG 1 cut(s) 664
Fnu4HI GCNGC 8 cut(s) 111, 156, 339, 348, 681, 690, 693, 745
FokI GGATG 3 cut(s) 123, 902, 932
FriOI GRGCYC 1 cut(s) 569
Fsp4HI GCNGC 8 cut(s) 111, 156, 339, 348, 681, 690, 693, 745
FspBI CTAG 1 cut(s) 704
FspI TGCGCA 1 cut(s) 377
GlaI GCGC 1 cut(s) 377
GluI GCNGC 8 cut(s) 111, 156, 339, 348, 681, 690, 693, 745
GsaI CCCAGC 1 cut(s) 572
GsuI CTGGAG 1 cut(s) 76
HaeIII GGCC 3 cut(s) 199, 400, 567
HgaI GACGC 1 cut(s) 110
HhaI GCGC 1 cut(s) 378
Hin1II CATG 6 cut(s) 46, 310, 322, 626, 803, 885
Hin6I GCGC 1 cut(s) 376
HinP1I GCGC 1 cut(s) 376
HincII GTYRAC 1 cut(s) 954
HindII GTYRAC 1 cut(s) 954
HpaI GTTAAC 1 cut(s) 954
HphI GGTGA 1 cut(s) 343
Hpy166II GTNNAC 2 cut(s) 595, 954
Hpy188I TCNGA 5 cut(s) 244, 365, 421, 517, 786
Hpy188III TCNNGA 4 cut(s) 124, 140, 290, 319
Hpy8I GTNNAC 2 cut(s) 595, 954
HpyAV CCTTC 3 cut(s) 145, 249, 764
HpyCH4III ACNGT 1 cut(s) 713
HpyCH4V TGCA 8 cut(s) 304, 341, 360, 608, 680, 692, 818, 881
HpyF10VI GCNNNNNNNGC 7 cut(s) 110, 344, 347, 614, 623, 686, 689
HpyF3I CTNAG 4 cut(s) 412, 471, 669, 827
Hsp92II CATG 6 cut(s) 46, 310, 322, 626, 803, 885
HspAI GCGC 1 cut(s) 376
KspAI GTTAAC 1 cut(s) 954
Kzo9I GATC 1 cut(s) 286
Lsp1109I GCAGC 8 cut(s) 122, 142, 325, 359, 676, 692, 704, 756
LweI GCATC 3 cut(s) 369, 617, 954
MaeI CTAG 1 cut(s) 704
MaeIII GTNAC 1 cut(s) 833
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 4 cut(s) 43, 139, 257, 977
MfeI CAATTG 1 cut(s) 265
MflI RGATCY 1 cut(s) 286
MhlI GDGCHC 2 cut(s) 569, 643
MluCI AATT 6 cut(s) 163, 265, 477, 545, 675, 727
MmeI TCCRAC 1 cut(s) 740
MnlI CCTC 7 cut(s) 51, 141, 175, 403, 439, 466, 885
MseI TTAA 5 cut(s) 674, 740, 776, 924, 953
MslI CAYNNNNRTG 3 cut(s) 311, 577, 648
MspCI CTTAAG 1 cut(s) 739
MspR9I CCNGG 1 cut(s) 403
MunI CAATTG 1 cut(s) 265
Mva1269I GAATGC 1 cut(s) 318
MvaI CCWGG 1 cut(s) 403
MwoI GCNNNNNNNGC 7 cut(s) 110, 344, 347, 614, 623, 686, 689
NdeI CATATG 1 cut(s) 664
NdeII GATC 1 cut(s) 286
NlaIII CATG 6 cut(s) 46, 310, 322, 626, 803, 885
NlaIV GGNNCC 6 cut(s) 86, 288, 566, 567, 823, 967
NmeAIII GCCGAG 1 cut(s) 175
NmuCI GTSAC 1 cut(s) 833
NsbI TGCGCA 1 cut(s) 377
NspI RCATGY 3 cut(s) 310, 626, 803
NspV TTCGAA 1 cut(s) 725
OliI CACNNNNGTG 1 cut(s) 648
PagI TCATGA 1 cut(s) 318
PasI CCCWGGG 1 cut(s) 402
PciI ACATGT 1 cut(s) 799
PcsI WCGNNNNNNNCGW 1 cut(s) 731
PctI GAATGC 1 cut(s) 318
PkrI GCNGC 8 cut(s) 112, 157, 340, 349, 682, 691, 694, 746
PpuMI RGGWCCY 1 cut(s) 821
PscI ACATGT 1 cut(s) 799
PshAI GACNNNNGTC 1 cut(s) 38
PshBI ATTAAT 1 cut(s) 924
PsiI TTATAA 1 cut(s) 437
Psp5II RGGWCCY 1 cut(s) 821
Psp6I CCWGG 1 cut(s) 401
PspFI CCCAGC 1 cut(s) 568
PspGI CCWGG 1 cut(s) 401
PspN4I GGNNCC 6 cut(s) 86, 288, 566, 567, 823, 967
PspOMI GGGCCC 1 cut(s) 565
PspPI GGNCC 4 cut(s) 399, 565, 566, 821
PspPPI RGGWCCY 1 cut(s) 821
PstI CTGCAG 1 cut(s) 694
PsuI RGATCY 1 cut(s) 286
RsaI GTAC 2 cut(s) 94, 1034
RsaNI GTAC 2 cut(s) 93, 1033
RseI CAYNNNNRTG 3 cut(s) 311, 577, 648
SaqAI TTAA 5 cut(s) 674, 740, 776, 924, 953
SatI GCNGC 8 cut(s) 111, 156, 339, 348, 681, 690, 693, 745
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 4 cut(s) 399, 565, 566, 821
ScrFI CCNGG 1 cut(s) 403
SduI GDGCHC 2 cut(s) 569, 643
SfaNI GCATC 3 cut(s) 369, 617, 954
SfcI CTRYAG 1 cut(s) 690
SfuI TTCGAA 1 cut(s) 725
SinI GGWCC 1 cut(s) 821
SmiMI CAYNNNNRTG 3 cut(s) 311, 577, 648
SmlI CTYRAG 2 cut(s) 394, 739
SmoI CTYRAG 2 cut(s) 394, 739
Sse9I AATT 6 cut(s) 163, 265, 477, 545, 675, 727
SsiI CCGC 1 cut(s) 522
SspMI CTAG 1 cut(s) 704
StyD4I CCNGG 1 cut(s) 401
StyI CCWWGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 713
TaqI TCGA 1 cut(s) 725
TasI AATT 6 cut(s) 163, 265, 477, 545, 675, 727
Tru1I TTAA 5 cut(s) 674, 740, 776, 924, 953
Tru9I TTAA 5 cut(s) 674, 740, 776, 924, 953
TscAI CASTG 1 cut(s) 690
TseFI GTSAC 1 cut(s) 833
TseI GCWGC 8 cut(s) 110, 155, 338, 347, 680, 689, 692, 744
Tsp45I GTSAC 1 cut(s) 833
TspDTI ATGAA 4 cut(s) 44, 335, 470, 990
TspGWI ACGGA 1 cut(s) 1020
TspRI CASTG 1 cut(s) 690
Vha464I CTTAAG 1 cut(s) 739
VpaK11BI GGWCC 1 cut(s) 821
VspI ATTAAT 1 cut(s) 924
XapI RAATTY 2 cut(s) 545, 727
XceI RCATGY 3 cut(s) 310, 626, 803
XcmI CCANNNNNNNNNTGG 1 cut(s) 576
XspI CTAG 1 cut(s) 704
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.