Rmu_co8469645.1_g000001

acid phosphatase activity

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8469645.1
Physical Location & Seq
Forward (+)
1 .. 625
625 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8469645.1_g000001.1.cds

Sequence Viewer

Length: 373 bp
agagattagtgctatttgtggttctcctttaacggacaacttagagaaagactttggaatgcctttgctgcattctagagtgtctaaaaacacttatatggagatcattgagaaagtgaatgataggttggcgtcctggaagagcaaagggttatccatggccggaagactaaccttgatccagtctgtaacttcttccattcccacctatgttatgcaaactgctaggccccctactagtgtttgtggggaattggataagttgaacaggaactttttatggggagacactgagagaaggcataaagtccacctctgtcagtggaacctcgtttgcagacctaagtgcaaggggcttgaaaagggcaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.89

Weight (kDa)

9.25

Isoelectric Point (pI)

39.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 173
AcoI YGGCCR 1 cut(s) 160
AcyI GRCGYC 1 cut(s) 132
AgsI TTSAA 2 cut(s) 266, 360
AhlI ACTAGT 1 cut(s) 237
AjnI CCWGG 1 cut(s) 135
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
Alw26I GTCTC 1 cut(s) 280
AlwI GGATC 1 cut(s) 173
AoxI GGCC 2 cut(s) 160, 228
ApeKI GCWGC 1 cut(s) 68
AspS9I GGNCC 1 cut(s) 229
BbsI GAAGAC 1 cut(s) 173
BbvI GCAGC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 137
BcoDI GTCTC 1 cut(s) 280
BcuI ACTAGT 1 cut(s) 237
BfaI CTAG 3 cut(s) 76, 226, 238
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 229
BmiI GGNNCC 2 cut(s) 231, 327
BmrFI CCNGG 1 cut(s) 137
BpiI GAAGAC 1 cut(s) 173
BsaHI GRCGYC 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 283
BseNI ACTGG 1 cut(s) 182
BseXI GCAGC 1 cut(s) 55
BshFI GGCC 2 cut(s) 162, 230
BsiSI CCGG 1 cut(s) 163
BsmAI GTCTC 1 cut(s) 280
BsmI GAATGC 2 cut(s) 64, 71
BsnI GGCC 2 cut(s) 162, 230
Bsp143I GATC 2 cut(s) 103, 178
Bsp19I CCATGG 1 cut(s) 157
BspANI GGCC 2 cut(s) 162, 230
BspCNI CTCAG 1 cut(s) 284
BspLI GGNNCC 2 cut(s) 231, 327
BspPI GGATC 1 cut(s) 173
BspQI GCTCTTC 1 cut(s) 135
BsrI ACTGG 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 157
BssMI GATC 2 cut(s) 103, 178
BssNI GRCGYC 1 cut(s) 132
BssT1I CCWWGG 1 cut(s) 157
Bst2UI CCWGG 1 cut(s) 137
Bst6I CTCTTC 1 cut(s) 135
BstACI GRCGYC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 41, 292, 343
BstDSI CCRYGG 1 cut(s) 157
BstKTI GATC 2 cut(s) 106, 181
BstMAI GTCTC 1 cut(s) 280
BstMBI GATC 2 cut(s) 103, 178
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 173
BsuRI GGCC 2 cut(s) 162, 230
BtgI CCRYGG 1 cut(s) 157
BtsIMutI CAGTG 2 cut(s) 289, 327
Cfr13I GGNCC 1 cut(s) 229
CseI GACGC 1 cut(s) 121
CviAII CATG 1 cut(s) 158
CviJI RGCY 3 cut(s) 162, 230, 356
CviKI_1 RGCY 3 cut(s) 162, 230, 356
DdeI CTNAG 3 cut(s) 41, 292, 343
DpnI GATC 2 cut(s) 105, 180
DpnII GATC 2 cut(s) 103, 178
EaeI YGGCCR 1 cut(s) 160
Eam1104I CTCTTC 1 cut(s) 135
EarI CTCTTC 1 cut(s) 135
Eco130I CCWWGG 1 cut(s) 157
EcoO109I RGGNCCY 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 157
ErhI CCWWGG 1 cut(s) 157
FaeI CATG 1 cut(s) 161
FaiI YATR 7 cut(s) 97, 99, 159, 211, 216, 281, 304
FatI CATG 1 cut(s) 157
Fnu4HI GCNGC 1 cut(s) 69
Fsp4HI GCNGC 1 cut(s) 69
FspBI CTAG 3 cut(s) 76, 226, 238
GluI GCNGC 1 cut(s) 69
HaeIII GGCC 2 cut(s) 162, 230
HapII CCGG 1 cut(s) 163
HgaI GACGC 1 cut(s) 121
Hin1I GRCGYC 1 cut(s) 132
Hin1II CATG 1 cut(s) 161
HpaII CCGG 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 311
Hpy188III TCNNGA 1 cut(s) 76
Hpy8I GTNNAC 1 cut(s) 311
HpyAV CCTTC 1 cut(s) 292
HpyCH4V TGCA 4 cut(s) 71, 218, 337, 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
HpyF3I CTNAG 3 cut(s) 41, 292, 343
Hsp92I GRCGYC 1 cut(s) 132
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 2 cut(s) 103, 178
LguI GCTCTTC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 122, 149, 176, 195, 254
Lsp1109I GCAGC 1 cut(s) 55
MaeI CTAG 3 cut(s) 76, 226, 238
MaeIII GTNAC 1 cut(s) 188
MalI GATC 2 cut(s) 105, 180
MboI GATC 2 cut(s) 103, 178
MboII GAAGA 3 cut(s) 152, 178, 187
MluCI AATT 1 cut(s) 252
MnlI CCTC 2 cut(s) 324, 339
MseI TTAA 1 cut(s) 30
MslI CAYNNNNRTG 1 cut(s) 96
MspI CCGG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 137
Mva1269I GAATGC 2 cut(s) 64, 71
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 68
NcoI CCATGG 1 cut(s) 157
NdeII GATC 2 cut(s) 103, 178
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 2 cut(s) 231, 327
PciSI GCTCTTC 1 cut(s) 135
PctI GAATGC 2 cut(s) 64, 71
PfoI TCCNGGA 1 cut(s) 135
PkrI GCNGC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 2 cut(s) 231, 327
PspPI GGNCC 1 cut(s) 229
RseI CAYNNNNRTG 1 cut(s) 96
SapI GCTCTTC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 30
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 2 cut(s) 103, 178
Sau96I GGNCC 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 137
SetI ASST 6 cut(s) 129, 177, 210, 316, 331, 344
SmiMI CAYNNNNRTG 1 cut(s) 96
SpeI ACTAGT 1 cut(s) 237
Sse9I AATT 1 cut(s) 252
SspMI CTAG 3 cut(s) 76, 226, 238
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 157
TasI AATT 1 cut(s) 252
Tru1I TTAA 1 cut(s) 30
Tru9I TTAA 1 cut(s) 30
TscAI CASTG 2 cut(s) 296, 327
TseI GCWGC 1 cut(s) 68
TspGWI ACGGA 1 cut(s) 48
TspRI CASTG 2 cut(s) 296, 327
XbaI TCTAGA 1 cut(s) 75
XspI CTAG 3 cut(s) 76, 226, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.