Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000927.1

Orthogroup ID

OG0016475

Physical Location & Seq

Genomic Coordinates Forward (+)

103728 .. 104778

Gene Structure 1051 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000927.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 882 bp

atgctgaggaaaaatctcaagtggagagttagggatggcaagaaaatcaagttctggtatgattactggctcctacctactgctctgatcaactttgctttaccttctgccactattaatgataatgccaccatttgtgaattttgggatgaaactggttgggatgctttgcttttagcttctgtggttcccagtgatttagtgagcttaattattaatgtcccaactggatttgatggttgtggtaatgatgtgcttatatggaatgcaacctcaaatgggtgcttttctgtcaaatctgcttacaactccatgttggatattaagggtccctgcaatcctcattggaatgctatctggaacttgagctgccctcctaagttgaagacttttatttggagtgtgttccataaaaaaattctcactaatgtgcaaagagccagaagaggcctcactgccaaccctacttgccccatttgcaattctgctgatgaaagtcttcttcatttatttagagattgccacaggaataaggtgatttttgatcctaagtttgtcatgcctgcctgccctgagatgatcatctgggattatgcagaagaatgggtatgtgcccaatcaaaggccaactctgacaccatgtacagctacactatgctgtcttggagtagacctcctacaaactacttcaaactgaacattgatgggactagaagttcctcttctgggaaaattggtgcaggaggggtgatcagagaccataatagcaactgggtggatgggtttcaatttaatcttggtgttggggaaattcttgatgctgaggcttggggtcttttctttggtttaaagttagcctcaaagcataagcatttttcatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

293

Amino Acids

33.16

Weight (kDa)

8.48

Isoelectric Point (pI)

33.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016475)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07656
prunus_persica	Prupe.2G199900_v2.0.a1 Prupe.7G019600_v2.0.a1
pyrus_communis	pycom07g06830
rosa_chinensis	RchiOBHm_Chr2g0089011
rosa_multiflora	Rmu_co8469645.1_g000001 Rmu_sc0000927.1_g000013 Rmu_sc0001192.1_g000009 Rmu_sc0001947.1_g000005 Rmu_sc0004165.1_g000033 Rmu_sc0012042.1_g000003
rosa_rugosa	Rorug01G0073000 Rorug04G0155000 Rorug04G0186300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	670
AclWI	GGATC	1 cut(s)	539
AcsI	RAATTY	3 cut(s)	140, 417, 810
AfaI	GTAC	1 cut(s)	644
AfiI	CCNNNNNNNGG	3 cut(s)	279, 622, 726
AgsI	TTSAA	3 cut(s)	385, 691, 788
AleI	CACNNNNGTG	1 cut(s)	428
AloI	GAACNNNNNNTCC	2 cut(s)	700, 732
AluBI	AGCT	4 cut(s)	179, 207, 369, 648
AluI	AGCT	4 cut(s)	179, 207, 369, 648
Alw26I	GTCTC	1 cut(s)	750
AlwI	GGATC	1 cut(s)	539
AoxI	GGCC	2 cut(s)	448, 624
ApeKI	GCWGC	1 cut(s)	369
ApoI	RAATTY	3 cut(s)	140, 417, 810
AseI	ATTAAT	2 cut(s)	117, 216
Asp700I	GAANNNNTTC	1 cut(s)	498
AspS9I	GGNCC	1 cut(s)	329
AsuHPI	GGTGA	2 cut(s)	547, 760
AvaII	GGWCC	1 cut(s)	329
BaeGI	GKGCMC	1 cut(s)	616
BbsI	GAAGAC	2 cut(s)	392, 491
BbvCI	CCTCAGC	2 cut(s)	5, 822
BbvI	GCAGC	1 cut(s)	356
BccI	CCATC	4 cut(s)	29, 230, 698, 773
BclI	TGATCA	3 cut(s)	87, 579, 750
BcoDI	GTCTC	1 cut(s)	750
BfaI	CTAG	1 cut(s)	711
BisI	GCNGC	1 cut(s)	370
BlsI	GCNGC	1 cut(s)	371
Bme18I	GGWCC	1 cut(s)	329
BmgT120I	GGNCC	1 cut(s)	329
BmiI	GGNNCC	4 cut(s)	71, 189, 330, 331
BmrI	ACTGGG	2 cut(s)	186, 781
BmsI	GCATC	2 cut(s)	154, 808
BmuI	ACTGGG	2 cut(s)	186, 781
BpiI	GAAGAC	2 cut(s)	392, 491
BplI	GAGNNNNNCTC	4 cut(s)	358, 390, 658, 690
Bpu10I	CCTNAGC	2 cut(s)	5, 822
BpuEI	CTTGAG	1 cut(s)	385
BsaBI	GATNNNNATC	1 cut(s)	581
BsaI	GGTCTC	1 cut(s)	750
Bsc4I	CCNNNNNNNGG	3 cut(s)	279, 622, 726
Bse1I	ACTGG	5 cut(s)	71, 160, 192, 232, 776
Bse8I	GATNNNNATC	1 cut(s)	581
BseGI	GGATG	4 cut(s)	40, 154, 169, 784
BseJI	GATNNNNATC	1 cut(s)	581
BseLI	CCNNNNNNNGG	3 cut(s)	279, 622, 726
BseMII	CTCAG	2 cut(s)	564, 813
BseNI	ACTGG	5 cut(s)	71, 160, 192, 232, 776
BseSI	GKGCMC	1 cut(s)	616
BseXI	GCAGC	1 cut(s)	356
BsgI	GTGCAG	1 cut(s)	759
BshFI	GGCC	2 cut(s)	450, 626
BslFI	GGGAC	3 cut(s)	206, 315, 721
BslI	CCNNNNNNNGG	3 cut(s)	279, 622, 726
BsmAI	GTCTC	1 cut(s)	750
BsmFI	GGGAC	3 cut(s)	206, 315, 721
BsmI	GAATGC	2 cut(s)	271, 355
BsnI	GGCC	2 cut(s)	450, 626
Bso31I	GGTCTC	1 cut(s)	750
Bsp1286I	GDGCHC	1 cut(s)	616
Bsp1407I	TGTACA	1 cut(s)	642
Bsp143I	GATC	4 cut(s)	87, 544, 579, 750
BspANI	GGCC	2 cut(s)	450, 626
BspCNI	CTCAG	2 cut(s)	565, 814
BspHI	TCATGA	1 cut(s)	878
BspLI	GGNNCC	4 cut(s)	71, 189, 330, 331
BspPI	GGATC	1 cut(s)	539
BspTNI	GGTCTC	1 cut(s)	750
BsrGI	TGTACA	1 cut(s)	642
BsrI	ACTGG	5 cut(s)	71, 160, 192, 232, 776
BssMI	GATC	4 cut(s)	87, 544, 579, 750
Bst6I	CTCTTC	2 cut(s)	439, 727
BstAUI	TGTACA	1 cut(s)	642
BstC8I	GCNNGC	2 cut(s)	564, 568
BstDEI	CTNAG	5 cut(s)	5, 378, 549, 573, 822
BstF5I	GGATG	4 cut(s)	40, 154, 169, 784
BstKTI	GATC	4 cut(s)	90, 547, 582, 753
BstMAI	GTCTC	1 cut(s)	750
BstMBI	GATC	4 cut(s)	87, 544, 579, 750
BstMWI	GCNNNNNNNGC	1 cut(s)	477
BstSLI	GKGCMC	1 cut(s)	616
BstV1I	GCAGC	1 cut(s)	356
BstV2I	GAAGAC	2 cut(s)	392, 491
BsuRI	GGCC	2 cut(s)	450, 626
BtsCI	GGATG	4 cut(s)	40, 154, 169, 784
BtsI	GCAGTG	1 cut(s)	453
BtsIMutI	CAGTG	2 cut(s)	199, 453
Cac8I	GCNNGC	2 cut(s)	564, 568
CciI	TCATGA	1 cut(s)	878
Cfr13I	GGNCC	1 cut(s)	329
Csp6I	GTAC	1 cut(s)	643
CviAII	CATG	4 cut(s)	313, 559, 640, 879
CviQI	GTAC	1 cut(s)	643
DdeI	CTNAG	5 cut(s)	5, 378, 549, 573, 822
DpnI	GATC	4 cut(s)	89, 546, 581, 752
DpnII	GATC	4 cut(s)	87, 544, 579, 750
DraI	TTTAAA	1 cut(s)	849
Eam1104I	CTCTTC	2 cut(s)	439, 727
EarI	CTCTTC	2 cut(s)	439, 727
Eco147I	AGGCCT	1 cut(s)	450
Eco31I	GGTCTC	1 cut(s)	750
Eco47I	GGWCC	1 cut(s)	329
EcoO109I	RGGNCCY	1 cut(s)	329
FaeI	CATG	4 cut(s)	316, 562, 643, 882
FalI	AAGNNNNNCTT	2 cut(s)	706, 738
FaqI	GGGAC	3 cut(s)	206, 315, 721
FatI	CATG	4 cut(s)	312, 558, 639, 878
FbaI	TGATCA	3 cut(s)	87, 579, 750
FblI	GTMKAC	1 cut(s)	670
Fnu4HI	GCNGC	1 cut(s)	370
FokI	GGATG	4 cut(s)	47, 161, 176, 791
Fsp4HI	GCNGC	1 cut(s)	370
FspBI	CTAG	1 cut(s)	711
GluI	GCNGC	1 cut(s)	370
HaeIII	GGCC	2 cut(s)	450, 626
Hin1II	CATG	4 cut(s)	316, 562, 643, 882
HphI	GGTGA	2 cut(s)	547, 760
Hpy166II	GTNNAC	1 cut(s)	671
Hpy188I	TCNGA	3 cut(s)	87, 634, 755
Hpy188III	TCNNGA	3 cut(s)	358, 815, 879
Hpy8I	GTNNAC	1 cut(s)	671
HpyAV	CCTTC	1 cut(s)	114
HpyCH4V	TGCA	6 cut(s)	269, 336, 433, 480, 596, 740
HpyF10VI	GCNNNNNNNGC	1 cut(s)	477
HpyF3I	CTNAG	5 cut(s)	5, 378, 549, 573, 822
Hsp92II	CATG	4 cut(s)	316, 562, 643, 882
KflI	GGGWCCC	1 cut(s)	329
Ksp22I	TGATCA	3 cut(s)	87, 579, 750
Kzo9I	GATC	4 cut(s)	87, 544, 579, 750
LmnI	GCTCC	1 cut(s)	75
Lsp1109I	GCAGC	1 cut(s)	356
LweI	GCATC	2 cut(s)	154, 808
MaeI	CTAG	1 cut(s)	711
MalI	GATC	4 cut(s)	89, 546, 581, 752
MboI	GATC	4 cut(s)	87, 544, 579, 750
MboII	GAAGA	6 cut(s)	397, 456, 491, 494, 611, 714
MhlI	GDGCHC	1 cut(s)	616
MluCI	AATT	7 cut(s)	140, 210, 417, 481, 732, 788, 810
MmeI	TCCRAC	1 cut(s)	297
MroXI	GAANNNNTTC	1 cut(s)	498
MseI	TTAA	6 cut(s)	117, 209, 216, 324, 792, 848
MslI	CAYNNNNRTG	2 cut(s)	348, 428
Mva1269I	GAATGC	2 cut(s)	271, 355
MwoI	GCNNNNNNNGC	1 cut(s)	477
NdeII	GATC	4 cut(s)	87, 544, 579, 750
NlaIII	CATG	4 cut(s)	316, 562, 643, 882
NlaIV	GGNNCC	4 cut(s)	71, 189, 330, 331
OliI	CACNNNNGTG	1 cut(s)	428
PagI	TCATGA	1 cut(s)	878
PceI	AGGCCT	1 cut(s)	450
PctI	GAATGC	2 cut(s)	271, 355
PdmI	GAANNNNTTC	1 cut(s)	498
PkrI	GCNGC	1 cut(s)	371
PpuMI	RGGWCCY	1 cut(s)	329
PshBI	ATTAAT	2 cut(s)	117, 216
Psp5II	RGGWCCY	1 cut(s)	329
PspN4I	GGNNCC	4 cut(s)	71, 189, 330, 331
PspPI	GGNCC	1 cut(s)	329
PspPPI	RGGWCCY	1 cut(s)	329
RsaI	GTAC	1 cut(s)	644
RsaNI	GTAC	1 cut(s)	643
RseI	CAYNNNNRTG	2 cut(s)	348, 428
SaqAI	TTAA	6 cut(s)	117, 209, 216, 324, 792, 848
SatI	GCNGC	1 cut(s)	370
Sau3AI	GATC	4 cut(s)	87, 544, 579, 750
Sau96I	GGNCC	1 cut(s)	329
SduI	GDGCHC	1 cut(s)	616
SetI	ASST	9 cut(s)	79, 106, 181, 209, 275, 371, 537, 650, 676
SfaNI	GCATC	2 cut(s)	154, 808
SinI	GGWCC	1 cut(s)	329
SmiMI	CAYNNNNRTG	2 cut(s)	348, 428
SmlI	CTYRAG	2 cut(s)	17, 364
SmoI	CTYRAG	2 cut(s)	17, 364
Sse9I	AATT	7 cut(s)	140, 210, 417, 481, 732, 788, 810
SseBI	AGGCCT	1 cut(s)	450
SspMI	CTAG	1 cut(s)	711
StuI	AGGCCT	1 cut(s)	450
TasI	AATT	7 cut(s)	140, 210, 417, 481, 732, 788, 810
TatI	WGTACW	1 cut(s)	642
Tru1I	TTAA	6 cut(s)	117, 209, 216, 324, 792, 848
Tru9I	TTAA	6 cut(s)	117, 209, 216, 324, 792, 848
TscAI	CASTG	2 cut(s)	199, 460
TseI	GCWGC	1 cut(s)	369
TspDTI	ATGAA	4 cut(s)	165, 494, 507, 867
TspRI	CASTG	2 cut(s)	199, 460
VpaK11BI	GGWCC	1 cut(s)	329
VspI	ATTAAT	2 cut(s)	117, 216
XapI	RAATTY	3 cut(s)	140, 417, 810
XmiI	GTMKAC	1 cut(s)	670
XmnI	GAANNNNTTC	1 cut(s)	498
XspI	CTAG	1 cut(s)	711

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.