Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001947.1

Orthogroup ID

OG0016475

Physical Location & Seq

Genomic Coordinates Reverse (-)

33957 .. 34391

Gene Structure 435 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001947.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 435 bp

atgatgactgtggttctgatatgtgttggagctagcaatgatcattttaccgtcacatcagcctaccttacgactgtgaaagaagaaaatattgctgattttccttggtccttgttatggaagttgcccatttctcctaaatcagaatacttcttttggcatggcaaggttcttactaatgttgaaagtgtcaaaagaagactgacttctgattccttatgtcctttatgccataatgaggctaaaaccttgcttcatttcctaagatattgtataggggctgaaggggtttggagtggtatcatttgttttgacactactgctagaactatgcatctggactggtatgcttgggtttctgctaatgctcactgcaggaaagattgttttggttgtcttcttcacatgttggttcttatggaagtgaggaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

144

Amino Acids

16.53

Weight (kDa)

7.61

Isoelectric Point (pI)

35.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016475)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07656
prunus_persica	Prupe.2G199900_v2.0.a1 Prupe.7G019600_v2.0.a1
pyrus_communis	pycom07g06830
rosa_chinensis	RchiOBHm_Chr2g0089011
rosa_multiflora	Rmu_co8469645.1_g000001 Rmu_sc0000927.1_g000013 Rmu_sc0001192.1_g000009 Rmu_sc0001947.1_g000005 Rmu_sc0004165.1_g000033 Rmu_sc0012042.1_g000003
rosa_rugosa	Rorug01G0073000 Rorug04G0155000 Rorug04G0186300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	303
AfiI	CCNNNNNNNGG	2 cut(s)	117, 238
AflIII	ACRYGT	1 cut(s)	405
AgsI	TTSAA	1 cut(s)	185
AluBI	AGCT	1 cut(s)	32
AluI	AGCT	1 cut(s)	32
AspS9I	GGNCC	1 cut(s)	108
AsuNHI	GCTAGC	1 cut(s)	32
AvaII	GGWCC	1 cut(s)	108
BbsI	GAAGAC	2 cut(s)	205, 389
BclI	TGATCA	1 cut(s)	40
BfaI	CTAG	2 cut(s)	33, 324
BfmI	CTRYAG	1 cut(s)	373
Bme18I	GGWCC	1 cut(s)	108
BmgT120I	GGNCC	1 cut(s)	108
BmsI	GCATC	1 cut(s)	343
BmtI	GCTAGC	1 cut(s)	36
BpiI	GAAGAC	2 cut(s)	205, 389
BsaJI	CCNNGG	1 cut(s)	104
Bsc4I	CCNNNNNNNGG	2 cut(s)	117, 238
Bse1I	ACTGG	1 cut(s)	347
Bse3DI	GCAATG	1 cut(s)	43
BseDI	CCNNGG	1 cut(s)	104
BseLI	CCNNNNNNNGG	2 cut(s)	117, 238
BseMI	GCAATG	1 cut(s)	43
BseNI	ACTGG	1 cut(s)	347
BslI	CCNNNNNNNGG	2 cut(s)	117, 238
Bsp143I	GATC	1 cut(s)	40
BspMAI	CTGCAG	1 cut(s)	377
BspOI	GCTAGC	1 cut(s)	36
BsrDI	GCAATG	1 cut(s)	43
BsrI	ACTGG	1 cut(s)	347
BssECI	CCNNGG	1 cut(s)	104
BssMI	GATC	1 cut(s)	40
BssT1I	CCWWGG	1 cut(s)	104
Bst4CI	ACNGT	3 cut(s)	10, 52, 76
BstC8I	GCNNGC	1 cut(s)	34
BstDEI	CTNAG	1 cut(s)	263
BstKTI	GATC	1 cut(s)	43
BstMBI	GATC	1 cut(s)	40
BstNSI	RCATGY	1 cut(s)	409
BstSFI	CTRYAG	1 cut(s)	373
BstV2I	GAAGAC	2 cut(s)	205, 389
BtsI	GCAGTG	1 cut(s)	370
BtsIMutI	CAGTG	1 cut(s)	370
Cac8I	GCNNGC	1 cut(s)	34
Cfr13I	GGNCC	1 cut(s)	108
CviAII	CATG	2 cut(s)	161, 406
CviJI	RGCY	4 cut(s)	32, 62, 242, 281
CviKI_1	RGCY	4 cut(s)	32, 62, 242, 281
DdeI	CTNAG	1 cut(s)	263
DpnI	GATC	1 cut(s)	42
DpnII	GATC	1 cut(s)	40
Eco130I	CCWWGG	1 cut(s)	104
Eco47I	GGWCC	1 cut(s)	108
Eco57I	CTGAAG	1 cut(s)	303
EcoT14I	CCWWGG	1 cut(s)	104
EcoT22I	ATGCAT	1 cut(s)	336
ErhI	CCWWGG	1 cut(s)	104
FaeI	CATG	2 cut(s)	164, 409
FalI	AAGNNNNNCTT	2 cut(s)	190, 222
FatI	CATG	2 cut(s)	160, 405
FbaI	TGATCA	1 cut(s)	40
FspBI	CTAG	2 cut(s)	33, 324
Hin1II	CATG	2 cut(s)	164, 409
HinfI	GANTC	1 cut(s)	212
Hpy188I	TCNGA	3 cut(s)	18, 145, 211
Hpy188III	TCNNGA	1 cut(s)	338
HpyAV	CCTTC	1 cut(s)	278
HpyCH4III	ACNGT	3 cut(s)	10, 52, 76
HpyCH4V	TGCA	2 cut(s)	334, 375
HpyF3I	CTNAG	1 cut(s)	263
Hsp92II	CATG	2 cut(s)	164, 409
Ksp22I	TGATCA	1 cut(s)	40
Kzo9I	GATC	1 cut(s)	40
LmnI	GCTCC	1 cut(s)	29
LpnPI	CCDG	3 cut(s)	323, 328, 361
LweI	GCATC	1 cut(s)	343
MaeI	CTAG	2 cut(s)	33, 324
MaeIII	GTNAC	1 cut(s)	52
MalI	GATC	1 cut(s)	42
MboI	GATC	1 cut(s)	40
MboII	GAAGA	4 cut(s)	95, 210, 389, 392
MmeI	TCCRAC	1 cut(s)	7
MnlI	CCTC	2 cut(s)	232, 420
Mph1103I	ATGCAT	1 cut(s)	336
NdeII	GATC	1 cut(s)	40
NheI	GCTAGC	1 cut(s)	32
NlaIII	CATG	2 cut(s)	164, 409
NmuCI	GTSAC	1 cut(s)	52
NsiI	ATGCAT	1 cut(s)	336
NspI	RCATGY	1 cut(s)	409
PciI	ACATGT	1 cut(s)	405
PfeI	GAWTC	1 cut(s)	212
PscI	ACATGT	1 cut(s)	405
PspPI	GGNCC	1 cut(s)	108
PstI	CTGCAG	1 cut(s)	377
Sau3AI	GATC	1 cut(s)	40
Sau96I	GGNCC	1 cut(s)	108
SetI	ASST	4 cut(s)	34, 69, 171, 251
SfaNI	GCATC	1 cut(s)	343
SfcI	CTRYAG	1 cut(s)	373
SinI	GGWCC	1 cut(s)	108
SspI	AATATT	1 cut(s)	91
SspMI	CTAG	2 cut(s)	33, 324
StyI	CCWWGG	1 cut(s)	104
TaaI	ACNGT	3 cut(s)	10, 52, 76
TfiI	GAWTC	1 cut(s)	212
TscAI	CASTG	1 cut(s)	377
TseFI	GTSAC	1 cut(s)	52
Tsp45I	GTSAC	1 cut(s)	52
TspDTI	ATGAA	1 cut(s)	245
TspRI	CASTG	1 cut(s)	377
VpaK11BI	GGWCC	1 cut(s)	108
XceI	RCATGY	1 cut(s)	409
XspI	CTAG	2 cut(s)	33, 324
Zsp2I	ATGCAT	1 cut(s)	336

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.