Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001192.1

Orthogroup ID

OG0016475

Physical Location & Seq

Genomic Coordinates Forward (+)

31372 .. 32339

Gene Structure 968 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001192.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 795 bp

atgaatcatgccatgctagctaaggctagttggagactttttcagcaagattctggcttatgggcttccatttactcagaaaagtatctcaaaaattgctatataactgatgataactacctgcccccacctgattgttctagtacctggagaagcatttcctatggtgctgttatgctgaggaaaaatctcaagtggagagttggggatggcaagaaaatcaagttttggtatgattactgggtcctacctattgctctgatcaactttgctttaccttctgccactattaatgataatgccaccatttgtgaattttgggatgaatctggttgggatgctttgcttttagcttctatggttcccaatgatttagtgagcttaattattaatgtcccaactggttttgatggttgtggtaatgacgtgcttatatggaatgcaacctccaatgggtgcttttctgtcaaatctgcttacaactccatgtttgatattaatggtccctgcaatcctcactggaatgctatttggaacttgagttgtcctcctaagctgaagacgtttatctggagtgctttccataaaaagattctcactaatgtgcaaagagccagaagaggcctcactgccaaccctacttgccccatttgcaattctgcttatgaaagtcttcttcatttatttagagattgccacagtacggtcgtgttcctccttgagaacttggttgtggtcgaagttgttgaggcagtggtacatattttgatggtgaaggcttggtttggacagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

264

Amino Acids

29.95

Weight (kDa)

7.53

Isoelectric Point (pI)

29.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016475)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G07656
prunus_persica	Prupe.2G199900_v2.0.a1 Prupe.7G019600_v2.0.a1
pyrus_communis	pycom07g06830
rosa_chinensis	RchiOBHm_Chr2g0089011
rosa_multiflora	Rmu_co8469645.1_g000001 Rmu_sc0000927.1_g000013 Rmu_sc0001192.1_g000009 Rmu_sc0001947.1_g000005 Rmu_sc0004165.1_g000033 Rmu_sc0012042.1_g000003
rosa_rugosa	Rorug01G0073000 Rorug04G0155000 Rorug04G0186300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	129
AcsI	RAATTY	1 cut(s)	314
AcuI	CTGAAG	1 cut(s)	578
AfaI	GTAC	3 cut(s)	145, 703, 759
AfiI	CCNNNNNNNGG	2 cut(s)	453, 703
AjiI	CACGTC	1 cut(s)	427
AjnI	CCWGG	1 cut(s)	146
AleI	CACNNNNGTG	1 cut(s)	602
AluBI	AGCT	4 cut(s)	20, 353, 381, 556
AluI	AGCT	4 cut(s)	20, 353, 381, 556
Alw26I	GTCTC	1 cut(s)	28
AoxI	GGCC	1 cut(s)	622
ApoI	RAATTY	1 cut(s)	314
AseI	ATTAAT	3 cut(s)	291, 390, 498
Asp700I	GAANNNNTTC	2 cut(s)	157, 672
AspS9I	GGNCC	2 cut(s)	244, 503
AsuHPI	GGTGA	1 cut(s)	784
AsuNHI	GCTAGC	1 cut(s)	16
AvaII	GGWCC	2 cut(s)	244, 503
BbsI	GAAGAC	2 cut(s)	566, 665
BbvCI	CCTCAGC	1 cut(s)	179
BccI	CCATC	3 cut(s)	203, 404, 763
BciT130I	CCWGG	1 cut(s)	148
BclI	TGATCA	1 cut(s)	261
BcoDI	GTCTC	1 cut(s)	28
BfaI	CTAG	3 cut(s)	17, 27, 141
BfuAI	ACCTGC	1 cut(s)	129
Bme1390I	CCNGG	1 cut(s)	148
Bme18I	GGWCC	2 cut(s)	244, 503
BmgBI	CACGTC	1 cut(s)	427
BmgT120I	GGNCC	2 cut(s)	244, 503
BmiI	GGNNCC	3 cut(s)	245, 363, 505
BmrFI	CCNGG	1 cut(s)	148
BmrI	ACTGGG	1 cut(s)	250
BmsI	GCATC	1 cut(s)	328
BmtI	GCTAGC	1 cut(s)	20
BmuI	ACTGGG	1 cut(s)	250
BpiI	GAAGAC	2 cut(s)	566, 665
BplI	GAGNNNNNCTC	2 cut(s)	532, 564
BpmI	CTGGAG	2 cut(s)	169, 592
Bpu10I	CCTNAGC	3 cut(s)	21, 179, 552
BpuEI	CTTGAG	3 cut(s)	176, 559, 740
Bsc4I	CCNNNNNNNGG	2 cut(s)	453, 703
Bse1I	ACTGG	3 cut(s)	245, 406, 524
BseBI	CCWGG	1 cut(s)	148
BseGI	GGATG	3 cut(s)	214, 328, 343
BseLI	CCNNNNNNNGG	2 cut(s)	453, 703
BseMII	CTCAG	2 cut(s)	90, 170
BseNI	ACTGG	3 cut(s)	245, 406, 524
Bsh1285I	CGRYCG	1 cut(s)	708
BshFI	GGCC	1 cut(s)	624
BsiEI	CGRYCG	1 cut(s)	708
BslFI	GGGAC	2 cut(s)	380, 489
BslI	CCNNNNNNNGG	2 cut(s)	453, 703
BsmAI	GTCTC	1 cut(s)	28
BsmFI	GGGAC	2 cut(s)	380, 489
BsmI	GAATGC	2 cut(s)	445, 529
BsnI	GGCC	1 cut(s)	624
Bsp143I	GATC	1 cut(s)	261
BspANI	GGCC	1 cut(s)	624
BspCNI	CTCAG	2 cut(s)	89, 171
BspLI	GGNNCC	3 cut(s)	245, 363, 505
BspMI	ACCTGC	1 cut(s)	129
BspOI	GCTAGC	1 cut(s)	20
BsrI	ACTGG	3 cut(s)	245, 406, 524
BssMI	GATC	1 cut(s)	261
Bst2UI	CCWGG	1 cut(s)	148
Bst4CI	ACNGT	3 cut(s)	701, 706, 792
Bst6I	CTCTTC	1 cut(s)	613
BstC8I	GCNNGC	1 cut(s)	18
BstDEI	CTNAG	4 cut(s)	21, 76, 179, 552
BstF5I	GGATG	3 cut(s)	214, 328, 343
BstKTI	GATC	1 cut(s)	264
BstMAI	GTCTC	1 cut(s)	28
BstMBI	GATC	1 cut(s)	261
BstMCI	CGRYCG	1 cut(s)	708
BstMWI	GCNNNNNNNGC	2 cut(s)	17, 651
BstNI	CCWGG	1 cut(s)	148
BstSCI	CCNGG	1 cut(s)	146
BstV2I	GAAGAC	2 cut(s)	566, 665
BsuRI	GGCC	1 cut(s)	624
BtrI	CACGTC	1 cut(s)	427
BtsCI	GGATG	3 cut(s)	214, 328, 343
BtsI	GCAGTG	2 cut(s)	627, 759
BtsIMutI	CAGTG	3 cut(s)	517, 627, 759
BveI	ACCTGC	1 cut(s)	129
Cac8I	GCNNGC	1 cut(s)	18
Cfr13I	GGNCC	2 cut(s)	244, 503
Csp6I	GTAC	3 cut(s)	144, 702, 758
CviAII	CATG	3 cut(s)	8, 13, 487
CviQI	GTAC	3 cut(s)	144, 702, 758
DdeI	CTNAG	4 cut(s)	21, 76, 179, 552
DpnI	GATC	1 cut(s)	263
DpnII	GATC	1 cut(s)	261
Eam1104I	CTCTTC	1 cut(s)	613
EarI	CTCTTC	1 cut(s)	613
Eco147I	AGGCCT	1 cut(s)	624
Eco47I	GGWCC	2 cut(s)	244, 503
Eco57I	CTGAAG	1 cut(s)	578
EcoO109I	RGGNCCY	1 cut(s)	244
EcoRII	CCWGG	1 cut(s)	146
FaeI	CATG	3 cut(s)	11, 16, 490
FaqI	GGGAC	2 cut(s)	380, 489
FatI	CATG	3 cut(s)	7, 12, 486
FbaI	TGATCA	1 cut(s)	261
FokI	GGATG	3 cut(s)	221, 335, 350
FspBI	CTAG	3 cut(s)	17, 27, 141
GsuI	CTGGAG	2 cut(s)	169, 592
HaeIII	GGCC	1 cut(s)	624
Hin1II	CATG	3 cut(s)	11, 16, 490
HinfI	GANTC	4 cut(s)	4, 50, 326, 592
HphI	GGTGA	1 cut(s)	784
Hpy188I	TCNGA	2 cut(s)	79, 261
Hpy188III	TCNNGA	1 cut(s)	571
HpyAV	CCTTC	2 cut(s)	288, 769
HpyCH4III	ACNGT	3 cut(s)	701, 706, 792
HpyCH4IV	ACGT	2 cut(s)	426, 563
HpyCH4V	TGCA	4 cut(s)	443, 510, 607, 654
HpyF10VI	GCNNNNNNNGC	2 cut(s)	17, 651
HpyF3I	CTNAG	4 cut(s)	21, 76, 179, 552
HpySE526I	ACGT	2 cut(s)	426, 563
Hsp92II	CATG	3 cut(s)	11, 16, 490
Ksp22I	TGATCA	1 cut(s)	261
Kzo9I	GATC	1 cut(s)	261
LweI	GCATC	1 cut(s)	328
MaeI	CTAG	3 cut(s)	17, 27, 141
MaeII	ACGT	2 cut(s)	426, 563
MalI	GATC	1 cut(s)	263
MboI	GATC	1 cut(s)	261
MboII	GAAGA	4 cut(s)	571, 630, 665, 668
MluCI	AATT	4 cut(s)	94, 314, 384, 655
MmeI	TCCRAC	1 cut(s)	11
MnlI	CCTC	8 cut(s)	174, 457, 525, 558, 614, 635, 725, 742
MroXI	GAANNNNTTC	2 cut(s)	157, 672
MseI	TTAA	4 cut(s)	291, 383, 390, 498
MslI	CAYNNNNRTG	2 cut(s)	522, 602
MspR9I	CCNGG	1 cut(s)	148
Mva1269I	GAATGC	2 cut(s)	445, 529
MvaI	CCWGG	1 cut(s)	148
MwoI	GCNNNNNNNGC	2 cut(s)	17, 651
NdeII	GATC	1 cut(s)	261
NheI	GCTAGC	1 cut(s)	16
NlaIII	CATG	3 cut(s)	11, 16, 490
NlaIV	GGNNCC	3 cut(s)	245, 363, 505
OliI	CACNNNNGTG	1 cut(s)	602
PceI	AGGCCT	1 cut(s)	624
PctI	GAATGC	2 cut(s)	445, 529
PdmI	GAANNNNTTC	2 cut(s)	157, 672
PfeI	GAWTC	4 cut(s)	4, 50, 326, 592
PpuMI	RGGWCCY	1 cut(s)	244
PshBI	ATTAAT	3 cut(s)	291, 390, 498
Psp5II	RGGWCCY	1 cut(s)	244
Psp6I	CCWGG	1 cut(s)	146
PspGI	CCWGG	1 cut(s)	146
PspN4I	GGNNCC	3 cut(s)	245, 363, 505
PspPI	GGNCC	2 cut(s)	244, 503
PspPPI	RGGWCCY	1 cut(s)	244
RsaI	GTAC	3 cut(s)	145, 703, 759
RsaNI	GTAC	3 cut(s)	144, 702, 758
RseI	CAYNNNNRTG	2 cut(s)	522, 602
SaqAI	TTAA	4 cut(s)	291, 383, 390, 498
Sau3AI	GATC	1 cut(s)	261
Sau96I	GGNCC	2 cut(s)	244, 503
ScrFI	CCNGG	1 cut(s)	148
SfaNI	GCATC	1 cut(s)	328
SinI	GGWCC	2 cut(s)	244, 503
SmiMI	CAYNNNNRTG	2 cut(s)	522, 602
SmlI	CTYRAG	3 cut(s)	191, 538, 719
SmoI	CTYRAG	3 cut(s)	191, 538, 719
Sse9I	AATT	4 cut(s)	94, 314, 384, 655
SseBI	AGGCCT	1 cut(s)	624
SspMI	CTAG	3 cut(s)	17, 27, 141
StuI	AGGCCT	1 cut(s)	624
StyD4I	CCNGG	1 cut(s)	146
TaaI	ACNGT	3 cut(s)	701, 706, 792
TaiI	ACGT	2 cut(s)	429, 566
TaqI	TCGA	1 cut(s)	738
TasI	AATT	4 cut(s)	94, 314, 384, 655
TfiI	GAWTC	4 cut(s)	4, 50, 326, 592
Tru1I	TTAA	4 cut(s)	291, 383, 390, 498
Tru9I	TTAA	4 cut(s)	291, 383, 390, 498
TscAI	CASTG	3 cut(s)	524, 634, 759
TspDTI	ATGAA	4 cut(s)	17, 339, 668, 681
TspRI	CASTG	3 cut(s)	524, 634, 759
VpaK11BI	GGWCC	2 cut(s)	244, 503
VspI	ATTAAT	3 cut(s)	291, 390, 498
XapI	RAATTY	1 cut(s)	314
XmnI	GAANNNNTTC	2 cut(s)	157, 672
XspI	CTAG	3 cut(s)	17, 27, 141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.