Rmu_co8470125.1_g000001

Zinc finger RNA-binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8470125.1
Physical Location & Seq
Reverse (-)
711 .. 1031
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8470125.1_g000001.1.cds

Sequence Viewer

Length: 321 bp
atggtacttgataagcataaaatgggaaagaagcaccagatgaacctggggaaattgaaaggcaaaactgttactggacaaacgagtaagaagaaggcagtttatccaactgaagacgatttgcagactaagaaacggagggttattgaaggtggtgcagcaccccatactttaaggacttgtactatatgtaacgtggtcagtattagtgcgacagatttctataaacatcttgctggacagcgacatagagatgctgctgcattgataagtaatggagctgggacgagtagctacagccagctgagaataagaaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.66

Weight (kDa)

10.22

Isoelectric Point (pI)

41.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012599)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 132
AfaI GTAC 2 cut(s) 6, 184
AgsI TTSAA 2 cut(s) 58, 149
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 3 cut(s) 281, 294, 304
AluI AGCT 3 cut(s) 281, 294, 304
ApeKI GCWGC 3 cut(s) 158, 257, 260
BbsI GAAGAC 1 cut(s) 120
BbvI GCAGC 3 cut(s) 170, 244, 247
BciT130I CCWGG 1 cut(s) 47
BfmI CTRYAG 1 cut(s) 295
BisI GCNGC 3 cut(s) 159, 258, 261
BlsI GCNGC 3 cut(s) 160, 259, 262
Bme1390I CCNGG 1 cut(s) 47
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 244
BpiI GAAGAC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 46
Bse1I ACTGG 1 cut(s) 79
BseBI CCWGG 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 296
BseNI ACTGG 1 cut(s) 79
BseXI GCAGC 3 cut(s) 170, 244, 247
BseYI CCCAGC 1 cut(s) 281
BsgI GTGCAG 1 cut(s) 177
BslFI GGGAC 1 cut(s) 298
BsmFI GGGAC 1 cut(s) 298
BspCNI CTCAG 1 cut(s) 297
BsrI ACTGG 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 302
BstDEI CTNAG 2 cut(s) 129, 305
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 45
BstSFI CTRYAG 1 cut(s) 295
BstV1I GCAGC 3 cut(s) 170, 244, 247
BstV2I GAAGAC 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 302
Csp6I GTAC 2 cut(s) 5, 183
CviJI RGCY 4 cut(s) 281, 294, 300, 304
CviKI_1 RGCY 4 cut(s) 281, 294, 300, 304
CviQI GTAC 2 cut(s) 5, 183
DdeI CTNAG 2 cut(s) 129, 305
Eco57I CTGAAG 1 cut(s) 132
EcoRII CCWGG 1 cut(s) 45
FaiI YATR 6 cut(s) 18, 168, 188, 190, 225, 249
FaqI GGGAC 1 cut(s) 298
Fnu4HI GCNGC 3 cut(s) 159, 258, 261
Fsp4HI GCNGC 3 cut(s) 159, 258, 261
GluI GCNGC 3 cut(s) 159, 258, 261
GsaI CCCAGC 1 cut(s) 285
HpyAV CCTTC 2 cut(s) 88, 143
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 195
HpyCH4V TGCA 3 cut(s) 124, 158, 263
HpyF3I CTNAG 2 cut(s) 129, 305
HpySE526I ACGT 1 cut(s) 195
LmnI GCTCC 1 cut(s) 278
LpnPI CCDG 7 cut(s) 32, 50, 59, 60, 222, 267, 314
Lsp1109I GCAGC 3 cut(s) 170, 244, 247
LweI GCATC 1 cut(s) 244
MaeII ACGT 1 cut(s) 195
MaeIII GTNAC 2 cut(s) 70, 191
MboII GAAGA 2 cut(s) 103, 125
MluCI AATT 2 cut(s) 53, 316
MmeI TCCRAC 1 cut(s) 131
MnlI CCTC 1 cut(s) 132
MseI TTAA 1 cut(s) 173
MslI CAYNNNNRTG 1 cut(s) 252
MspA1I CMGCKG 1 cut(s) 304
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
PkrI GCNGC 3 cut(s) 160, 259, 262
Psp6I CCWGG 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 281
PspGI CCWGG 1 cut(s) 45
PvuII CAGCTG 1 cut(s) 304
RsaI GTAC 2 cut(s) 6, 184
RsaNI GTAC 2 cut(s) 5, 183
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 1 cut(s) 173
SatI GCNGC 3 cut(s) 159, 258, 261
ScrFI CCNGG 1 cut(s) 47
SetI ASST 6 cut(s) 48, 154, 198, 283, 296, 306
SfaNI GCATC 1 cut(s) 244
SfcI CTRYAG 1 cut(s) 295
SmiMI CAYNNNNRTG 1 cut(s) 252
Sse9I AATT 2 cut(s) 53, 316
StyD4I CCNGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 198
TasI AATT 2 cut(s) 53, 316
TatI WGTACW 1 cut(s) 182
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TseI GCWGC 3 cut(s) 158, 257, 260
TspDTI ATGAA 1 cut(s) 56
TspGWI ACGGA 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.