Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8522595.1

Orthogroup ID

OG0004421

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 8025

Gene Structure 8025 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8522595.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 4155 bp

agttgtccggaggattcatcattgggaagcggatcacaggctgaagcagtttcaggtgctgattaccgtgaggatacactgctccaaagtggatcgcaagttttaaaagcagaatcatcagctgatttagggggtttcggatcatggcatcctccatacagctctgaagcttcggattctggggcagggcgtccaggtggttcctttgattatgcagggaaccttgcaatgttctctgactacaaagatagcaaaccaacagcatacactggctctcctggtccatggcatcctccatatatctcagaagcatcagattctgtggcagggggtccaggtggttcctttgagtgtggagggaaccctgcaatgtctattgacaggaaaccaccagcacagaccagctctcatgggcaaatgttccctacaagtcttaaagactggttttcgttggttccgtgcacggagacttacttcactgagagggttgacgtttcacagcccactagtagcaccacttctagttttgaagaaggacatactaatcatgttttagaccacggagatcttaatgtcctgcaggggaaagcagatgtggcagggaaagttgattctgaatattcttcacaaaaccttggtattgataacatggacatgaattccagaccatatggtgctttgggggaaaacaccccagaaaccttgggaccatcggaaaataattcttgtacatctatggaaataccctttctagatatagatatatgttcaccacatgttacttctaccgaatctactctctgtcaaaattctgatcttttcagtgaccattatacagctgcggatggtaggagcttagacaatagatatttggcagagtcctcaatccagcatagtccttatagctactactctacattatttccaagtaacaaagaaatggtgacgaatgtgaaggatgaatcactggagtttcacgctgatagttcatgctcaagcagtaagatgcatatcaattgtcaggagggaataaccggtacatatggctttgattcgccaatgattgatgcttcagatatcaaggagtggaattttgattatggaagatataattgtatttcggctgttagtgggaattcttcattggatgctgactcttgtcctgttgacaacaaggcttcagtcaagcctttgggttctactgagacatacatgtcaagcaaacgggaattcactggtgtgaaggatgaaaatattgatgagttggttgctcctagtactgatacgtttcattctttttcattcatggatgacagtagaaagccatcttacaatgctgatggtagctcttttgacaaggaaccaaagctctcaggttatgatgtatctactcagccttttggaaattcagggcatgctaaagaagagatgattgttgatactaagagaacttattattctgaaggtaatataaatggaagttctttaccccatgttggtggtggatatgtgaatctaaatggtttggaacatcagttgccagctgctcagccattctcttcaaacatgaatcagggttatagtacggacagacttgaggaagatgactatgatgtatgcattattgaagataagagtgatcctgcacccacacgtcgccttccagtggttagcaatactcgttacctggagcccttgaatcgctctctagcagttggaagtaacatcgttaattcacaacaatctagtgatcacgacacaggagtgggaggcataccattcaggacaagggaggagcaattgatcttgagagtagcattgcaggatctttcacagcccaagtcagaagctcttccaccagatggagttttaacagtacctctcttacgacatcagagaatcgcattgtcatggatggttcagaaggagacagctagcttgccttgttgcggaggaatacttgcagatgatcagggattgggaaaaacgatatcgacaattgcactcatacttaaggaaaggcctcctgcttctggagcctgtctagatgaaaaaaagtgcaagctagaaactctggatttggaccaggatgatgacatgcttcctgaggttagcagaaggaagcaagatgctgatgctcattcaagtgtctcaaatgaaacttctgagaagagcatgacatctttgatacaaacaaagggaaggccagcttgtggaacactcgttgtttgtcccaccagtgtcttgcggcaatgggcagaggagttgcgtaataaaataacagaaaaagctaaactctcagtgctagtctaccatggaggcaatcgaacgagggatccgtgtgagctagctaagtatgatgtggtcctcacaacatattcaattgtcagcatggaggtcccaaagcagcctcttgctgatggagaagatgaggagaaaggaaagcgagaggagtatgattctccacatatggggttttcatctaagaaaaggaaatatcctaataaatgctcaaagggtaagaagggattggagactgcagcgcttgagtctcttgctcgccctcttgctaaggttggatggtttagggttgtcttggatgaagcccagagtattaagaatcacagaactcaagtagctagggcctgttgggggcttcgagcgaaacgtaggtggtgcttatcggggacacctatccagaatgcgattgatgatctttatagctacttcagatttctgagatatgacccttatgcggtgtacaagtcgttttgtgcaaaaataaaatttccaattagtaagaatccagcaaaagggtacagaatgctgcaagctgttctgaagacaattatgttacgccgcacaaaaggcactcttcttgatggagaacctattattaatttaccgccaaaatttatagaactgaaaagggtggaattctccgcggaagaacgagatttttactcaaggctagagagtgattcacgcgctcaatttgaagaatatgcagctgctggaactgtgaaacaaaattatgttaatattttattgatgctcttgcgacttcgacaagcttgtgatcaccctcttcttgtcagacgttatgaatcacagtctttatggaaatcttcggttgagaaggcaaagaagcttactcatgacaaacaagtatcccttctgaattgtttggaagcttctttggcaatatgcggtatctgcaatgatgcacctgaagatgccgttgtttctgaatgtggtcatgtcttctgtagccaatgcatttttgactatctcactggtgatgacaaccagtgccccaacacaagttgcaaagttcgactgaatgtgtcttctgtcttttcaaaagccactttaaacagttcgctttctgaccaacctagtcaagggggcatgggttctgaagtttttgatgctgtagagtctttctatgaggatagctcgtacaattcatccaagattaaggctgcacttgaggttctctgcttgatgtgtaaaccaaagacttgcactacagaaaatagttgcttaccagaaagcgttgataaaaatgccagctgttctacaacatcttttgacattgatggggctgagtcccttgaggacagttctgatggacagaacttgggtgtggacaaaagtcctaagaaaattgagaaggtagttcgagaaaaagcaatagtcttttcacagtggactaggatgctggacttgcttgaagcgtgtcttaaaacttccggccttgagtacagaagacttgatggaacaatgtcagttgttgccagagataaagctgtaaaggattttaacactcttcctgaggtgtcagttatgattatgtctttgaaagctgctagtcttggtctgaacatggttgcagcctgccatgtacttcttttggacctgtggtggaatcctacgactgaagatcaagcaattgatagagcacatcgtattgggcagactcgtcctgttacggttttacggttgactgtgagagatacggtcgaagatcgtattttagctcttcagaaaaagaagagagagatggtggcatctgcatttggagaggatgagactggtggtcgtcagactcgcttaacagttgatgatctcaagtacctgtttatgaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000724 GO:0000725 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009292 GO:0009294 GO:0009987 GO:0033554 GO:0034641 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0044764 GO:0045003 GO:0046483 GO:0050896 GO:0051704 GO:0051716 GO:0071704 GO:0090304 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Helicase_C SNF2_N zf-C3HC4 zf-C3HC4_2

Protein Analysis

1384

Amino Acids

152.3

Weight (kDa)

5.21

Isoelectric Point (pI)

53.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004421)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11100 AT1G11100 AT1G11100 AT1G11100 AT1G11100 AT1G61140 AT1G61140 AT1G61140
fragaria_vesca	FvH4_3g04580 FvH4_3g04580 FvH4_3g04580 FvH4_3g04580 FvH4_3g04580
malus_domestica	MD05G1322200.v1.1 MD10G1300200.v1.1
prunus_persica	Prupe.4G040600_v2.0.a1 Prupe.4G040600_v2.0.a1
pyrus_communis	pycom05g29650 pycom10g25290
rosa_chinensis	RchiOBHm_Chr5g0007521
rosa_laevigata	RLG00000031464
rosa_multiflora	Rmu_co8522595.1_g000001 Rmu_ssc0000182.1_g000011
rosa_roxburghii	Rroxscaffold_1G00068890
rosa_rugosa	Rorug04G0427800 Rorug04G0427900 Rorug04G0428000
rosa_samantha	Rh5AG055800 Rh5BG053400 Rh5CG063200 Rh5DG052400
rosa_wichuraiana	Rw5G005420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1213
AccB7I	CCANNNNNTGG	2 cut(s)	1862, 2213
AccI	GTMKAC	1 cut(s)	2310
AccII	CGCG	2 cut(s)	2945, 2988
AccIII	TCCGGA	1 cut(s)	7
AclWI	GGATC	7 cut(s)	40, 100, 148, 1634, 1833, 2330, 2343
AcsI	RAATTY	9 cut(s)	658, 808, 1090, 1135, 1229, 1405, 2786, 2912, 2936
AcyI	GRCGYC	1 cut(s)	190
AfeI	AGCGCT	1 cut(s)	2544
AflII	CTTAAG	1 cut(s)	2012
AflIII	ACRYGT	3 cut(s)	775, 1212, 1652
AgeI	ACCGGT	1 cut(s)	1034
AhdI	GACNNNNNGTC	1 cut(s)	4101
AhlI	ACTAGT	1 cut(s)	506
AjiI	CACGTC	1 cut(s)	1655
AjnI	CCWGG	5 cut(s)	193, 277, 334, 1686, 2085
AjuI	GAANNNNNNNTTGG	2 cut(s)	1127, 1159
AleI	CACNNNNGTG	2 cut(s)	1238, 1763
AloI	GAACNNNNNNTCC	2 cut(s)	2320, 2352
Alw21I	GWGCWC	2 cut(s)	464, 3967
Alw26I	GTCTC	7 cut(s)	461, 1199, 1922, 2155, 2528, 2556, 4088
Alw44I	GTGCAC	1 cut(s)	460
AlwI	GGATC	7 cut(s)	40, 100, 148, 1634, 1833, 2330, 2343
AlwNI	CAGNNNCTG	3 cut(s)	59, 320, 3014
Aor13HI	TCCGGA	1 cut(s)	7
Aor51HI	AGCGCT	1 cut(s)	2544
AoxI	GGCC	4 cut(s)	2021, 2204, 2643, 3757
ApaLI	GTGCAC	1 cut(s)	460
ApoI	RAATTY	9 cut(s)	658, 808, 1090, 1135, 1229, 1405, 2786, 2912, 2936
AseI	ATTAAT	1 cut(s)	2898
AsiGI	ACCGGT	1 cut(s)	1034
Asp700I	GAANNNNTTC	1 cut(s)	1851
AspLEI	GCGC	2 cut(s)	2545, 2990
AspS9I	GGNCC	8 cut(s)	281, 332, 707, 2083, 2365, 2398, 2643, 3919
AsuHPI	GGTGA	4 cut(s)	762, 955, 3074, 3311
AsuNHI	GCTAGC	2 cut(s)	1934, 2347
AvaII	GGWCC	7 cut(s)	281, 332, 707, 2083, 2365, 2398, 3919
AxyI	CCTNAGG	2 cut(s)	2106, 3837
BaeGI	GKGCMC	2 cut(s)	464, 3317
BamHI	GGATCC	1 cut(s)	2335
BanII	GRGCYC	1 cut(s)	1695
BarI	GAAGNNNNNNTAC	2 cut(s)	502, 534
BbsI	GAAGAC	4 cut(s)	2849, 3256, 3342, 3778
Bbv12I	GWGCWC	2 cut(s)	464, 3967
BceAI	ACGGC	1 cut(s)	3224
BciT130I	CCWGG	5 cut(s)	195, 279, 336, 1688, 2087
BciVI	GTATCC	2 cut(s)	67, 3181
BclI	TGATCA	3 cut(s)	1750, 1969, 3079
BcoDI	GTCTC	7 cut(s)	461, 1199, 1922, 2155, 2528, 2556, 4088
BcuI	ACTAGT	1 cut(s)	506
BfmI	CTRYAG	5 cut(s)	578, 2538, 3268, 3435, 3531
BfoI	RGCGCY	1 cut(s)	2546
BfrI	CTTAAG	1 cut(s)	2012
BfuI	GTATCC	2 cut(s)	67, 3181
BglII	AGATCT	1 cut(s)	565
BlpI	GCTNAGC	1 cut(s)	1548
BmcAI	AGTACT	1 cut(s)	1279
Bme1390I	CCNGG	5 cut(s)	195, 279, 336, 1688, 2087
Bme18I	GGWCC	7 cut(s)	281, 332, 707, 2083, 2365, 2398, 3919
BmeRI	GACNNNNNGTC	1 cut(s)	4101
BmgBI	CACGTC	1 cut(s)	1655
BmgT120I	GGNCC	8 cut(s)	281, 332, 707, 2083, 2365, 2398, 2643, 3919
BmrFI	CCNGG	5 cut(s)	195, 279, 336, 1688, 2087
BmtI	GCTAGC	2 cut(s)	1938, 2351
BoxI	GACNNNNGTC	2 cut(s)	1158, 3657
BpiI	GAAGAC	4 cut(s)	2849, 3256, 3342, 3778
BplI	GAGNNNNNCTC	2 cut(s)	3443, 3475
BpmI	CTGGAG	3 cut(s)	989, 1709, 2055
Bpu10I	CCTNAGC	1 cut(s)	2571
Bpu1102I	GCTNAGC	1 cut(s)	1548
BsaBI	GATNNNNATC	1 cut(s)	1010
BsaHI	GRCGYC	1 cut(s)	190
BsaJI	CCNNGG	6 cut(s)	284, 559, 634, 702, 2314, 2943
BsaWI	WCCGGW	2 cut(s)	7, 1034
BsaXI	ACNNNNNCTCC	2 cut(s)	259, 289
Bse118I	RCCGGY	1 cut(s)	1034
Bse1I	ACTGG	9 cut(s)	274, 446, 972, 1240, 1664, 2238, 3301, 3310, 4102
Bse21I	CCTNAGG	2 cut(s)	2106, 3837
Bse3DI	GCAATG	5 cut(s)	234, 375, 1817, 2258, 3226
Bse8I	GATNNNNATC	1 cut(s)	1010
BseAI	TCCGGA	1 cut(s)	7
BseBI	CCWGG	5 cut(s)	195, 279, 336, 1688, 2087
BseDI	CCNNGG	6 cut(s)	284, 559, 634, 702, 2314, 2943
BseJI	GATNNNNATC	1 cut(s)	1010
BseMI	GCAATG	5 cut(s)	234, 375, 1817, 2258, 3226
BseNI	ACTGG	9 cut(s)	274, 446, 972, 1240, 1664, 2238, 3301, 3310, 4102
BseRI	GAGGAG	4 cut(s)	1808, 2276, 2447, 2465
BseSI	GKGCMC	2 cut(s)	464, 3317
BsgI	GTGCAG	2 cut(s)	1629, 3471
Bsh1236I	CGCG	2 cut(s)	2945, 2988
Bsh1285I	CGRYCG	1 cut(s)	4026
BshFI	GGCC	4 cut(s)	2023, 2206, 2645, 3759
BshTI	ACCGGT	1 cut(s)	1034
BsiEI	CGRYCG	1 cut(s)	4026
BsiHKAI	GWGCWC	2 cut(s)	464, 3967
BsiSI	CCGG	3 cut(s)	8, 1035, 3756
BslFI	GGGAC	5 cut(s)	720, 2217, 2384, 2701, 3598
BsmAI	GTCTC	7 cut(s)	461, 1199, 1922, 2155, 2528, 2556, 4088
BsmFI	GGGAC	5 cut(s)	720, 2217, 2384, 2701, 3598
BsmI	GAATGC	2 cut(s)	2707, 2829
BsnI	GGCC	4 cut(s)	2023, 2206, 2645, 3759
Bsp1286I	GDGCHC	4 cut(s)	464, 1695, 3317, 3967
Bsp13I	TCCGGA	1 cut(s)	7
Bsp1407I	TGTACA	2 cut(s)	728, 2760
Bsp1720I	GCTNAGC	1 cut(s)	1548
Bsp19I	CCATGG	2 cut(s)	284, 2314
BspANI	GGCC	4 cut(s)	2023, 2206, 2645, 3759
BspEI	TCCGGA	1 cut(s)	7
BspFNI	CGCG	2 cut(s)	2945, 2988
BspHI	TCATGA	1 cut(s)	3157
BspMAI	CTGCAG	2 cut(s)	582, 2542
BspOI	GCTAGC	2 cut(s)	1938, 2351
BspPI	GGATC	7 cut(s)	40, 100, 148, 1634, 1833, 2330, 2343
BspQI	GCTCTTC	3 cut(s)	1857, 2165, 4050
BspTI	CTTAAG	1 cut(s)	2012
BsrDI	GCAATG	5 cut(s)	234, 375, 1817, 2258, 3226
BsrFI	RCCGGY	1 cut(s)	1034
BsrGI	TGTACA	2 cut(s)	728, 2760
BsrI	ACTGG	9 cut(s)	274, 446, 972, 1240, 1664, 2238, 3301, 3310, 4102
BssAI	RCCGGY	1 cut(s)	1034
BssECI	CCNNGG	6 cut(s)	284, 559, 634, 702, 2314, 2943
BssNI	GRCGYC	1 cut(s)	190
BssT1I	CCWWGG	4 cut(s)	284, 634, 702, 2314
Bst2UI	CCWGG	5 cut(s)	195, 279, 336, 1688, 2087
Bst6I	CTCTTC	9 cut(s)	1419, 1564, 1857, 2165, 2880, 3093, 3837, 4050, 4052
BstACI	GRCGYC	1 cut(s)	190
BstAFI	CTTAAG	1 cut(s)	2012
BstAUI	TGTACA	2 cut(s)	728, 2760
BstDSI	CCRYGG	4 cut(s)	284, 559, 2314, 2943
BstENI	CCTNNNNNAGG	1 cut(s)	3402
BstFNI	CGCG	2 cut(s)	2945, 2988
BstH2I	RGCGCY	1 cut(s)	2546
BstHHI	GCGC	2 cut(s)	2545, 2990
BstMAI	GTCTC	7 cut(s)	461, 1199, 1922, 2155, 2528, 2556, 4088
BstMCI	CGRYCG	1 cut(s)	4026
BstMWI	GCNNNNNNNGC	6 cut(s)	596, 2036, 2868, 3200, 3216, 3730
BstNI	CCWGG	5 cut(s)	195, 279, 336, 1688, 2087
BstNSI	RCATGY	4 cut(s)	779, 1216, 1418, 2101
BstPAI	GACNNNNGTC	2 cut(s)	1158, 3657
BstSCI	CCNGG	5 cut(s)	193, 277, 334, 1686, 2085
BstSFI	CTRYAG	5 cut(s)	578, 2538, 3268, 3435, 3531
BstSLI	GKGCMC	2 cut(s)	464, 3317
BstUI	CGCG	2 cut(s)	2945, 2988
BstV2I	GAAGAC	4 cut(s)	2849, 3256, 3342, 3778
BstX2I	RGATCY	3 cut(s)	565, 1825, 2335
BstXI	CCANNNNNNTGG	1 cut(s)	1499
BstYI	RGATCY	3 cut(s)	565, 1825, 2335
Bsu36I	CCTNAGG	2 cut(s)	2106, 3837
BsuI	GTATCC	2 cut(s)	67, 3181
BsuRI	GGCC	4 cut(s)	2023, 2206, 2645, 3759
BtgI	CCRYGG	4 cut(s)	284, 559, 2314, 2943
BtrI	CACGTC	1 cut(s)	1655
BtsI	GCAGTG	1 cut(s)	77
CaiI	CAGNNNCTG	3 cut(s)	59, 320, 3014
CciI	TCATGA	1 cut(s)	3157
CfoI	GCGC	2 cut(s)	2545, 2990
Cfr10I	RCCGGY	1 cut(s)	1034
Cfr13I	GGNCC	8 cut(s)	281, 332, 707, 2083, 2365, 2398, 2643, 3919
Cfr42I	CCGCGG	1 cut(s)	2946
CseI	GACGC	1 cut(s)	179
CspAI	ACCGGT	1 cut(s)	1034
DraI	TTTAAA	2 cut(s)	105, 3375
DrdI	GACNNNNNNGTC	1 cut(s)	1213
DriI	GACNNNNNGTC	1 cut(s)	4101
DseDI	GACNNNNNNGTC	1 cut(s)	1213
Eam1104I	CTCTTC	9 cut(s)	1419, 1564, 1857, 2165, 2880, 3093, 3837, 4050, 4052
Eam1105I	GACNNNNNGTC	1 cut(s)	4101
EarI	CTCTTC	9 cut(s)	1419, 1564, 1857, 2165, 2880, 3093, 3837, 4050, 4052
Eco130I	CCWWGG	4 cut(s)	284, 634, 702, 2314
Eco147I	AGGCCT	1 cut(s)	2023
Eco24I	GRGCYC	1 cut(s)	1695
Eco32I	GATATC	2 cut(s)	1078, 1992
Eco47I	GGWCC	7 cut(s)	281, 332, 707, 2083, 2365, 2398, 3919
Eco47III	AGCGCT	1 cut(s)	2544
Eco81I	CCTNAGG	2 cut(s)	2106, 3837
EcoNI	CCTNNNNNAGG	1 cut(s)	3402
EcoO109I	RGGNCCY	2 cut(s)	2398, 2643
EcoRI	GAATTC	4 cut(s)	658, 1135, 1229, 2936
EcoRII	CCWGG	5 cut(s)	193, 277, 334, 1686, 2085
EcoRV	GATATC	2 cut(s)	1078, 1992
EcoT14I	CCWWGG	4 cut(s)	284, 634, 702, 2314
EcoT22I	ATGCAT	3 cut(s)	1011, 1622, 3281
EcoT38I	GRGCYC	1 cut(s)	1695
ErhI	CCWWGG	4 cut(s)	284, 634, 702, 2314
FalI	AAGNNNNNCTT	8 cut(s)	2194, 2226, 2859, 2891, 3159, 3191, 3729, 3761
FaqI	GGGAC	5 cut(s)	720, 2217, 2384, 2701, 3598
FauNDI	CATATG	3 cut(s)	670, 1042, 2469
FbaI	TGATCA	3 cut(s)	1750, 1969, 3079
FblI	GTMKAC	1 cut(s)	2310
FriOI	GRGCYC	1 cut(s)	1695
GlaI	GCGC	2 cut(s)	2544, 2989
GsuI	CTGGAG	3 cut(s)	989, 1709, 2055
HaeII	RGCGCY	1 cut(s)	2546
HaeIII	GGCC	4 cut(s)	2023, 2206, 2645, 3759
HapII	CCGG	3 cut(s)	8, 1035, 3756
HgaI	GACGC	1 cut(s)	179
HhaI	GCGC	2 cut(s)	2545, 2990
Hin1I	GRCGYC	1 cut(s)	190
Hin6I	GCGC	2 cut(s)	2543, 2988
HinP1I	GCGC	2 cut(s)	2543, 2988
HincII	GTYRAC	3 cut(s)	490, 1168, 4008
HindII	GTYRAC	3 cut(s)	490, 1168, 4008
HindIII	AAGCTT	4 cut(s)	168, 3072, 3149, 3192
HpaII	CCGG	3 cut(s)	8, 1035, 3756
HphI	GGTGA	4 cut(s)	762, 955, 3074, 3311
Hpy99I	CGWCG	1 cut(s)	1659
HpyCH4IV	ACGT	5 cut(s)	492, 1286, 1654, 2668, 3100
HpyF10VI	GCNNNNNNNGC	6 cut(s)	596, 2036, 2868, 3200, 3216, 3730
HpySE526I	ACGT	5 cut(s)	492, 1286, 1654, 2668, 3100
Hsp92I	GRCGYC	1 cut(s)	190
HspAI	GCGC	2 cut(s)	2543, 2988
Kpn2I	TCCGGA	1 cut(s)	7
Ksp22I	TGATCA	3 cut(s)	1750, 1969, 3079
KspI	CCGCGG	1 cut(s)	2946
LguI	GCTCTTC	3 cut(s)	1857, 2165, 4050
LmnI	GCTCC	6 cut(s)	87, 852, 1276, 1690, 1795, 2036
MaeII	ACGT	5 cut(s)	492, 1286, 1654, 2668, 3100
MaeIII	GTNAC	8 cut(s)	778, 824, 929, 943, 1682, 1721, 2853, 3991
MfeI	CAATTG	5 cut(s)	1015, 1799, 1998, 2382, 3954
MflI	RGATCY	3 cut(s)	565, 1825, 2335
MhlI	GDGCHC	4 cut(s)	464, 1695, 3317, 3967
MlyI	GAGTC	7 cut(s)	887, 1148, 2558, 3449, 3620, 3976, 4105
MmeI	TCCRAC	2 cut(s)	1696, 2557
Mph1103I	ATGCAT	3 cut(s)	1011, 1622, 3281
MroI	TCCGGA	1 cut(s)	7
MroXI	GAANNNNTTC	1 cut(s)	1851
MslI	CAYNNNNRTG	6 cut(s)	653, 1238, 1497, 1763, 1909, 2145
MspA1I	CMGCKG	6 cut(s)	122, 839, 1544, 2945, 3011, 3576
MspCI	CTTAAG	1 cut(s)	2012
MspI	CCGG	3 cut(s)	8, 1035, 3756
MspR9I	CCNGG	5 cut(s)	195, 279, 336, 1688, 2087
MunI	CAATTG	5 cut(s)	1015, 1799, 1998, 2382, 3954
Mva1269I	GAATGC	2 cut(s)	2707, 2829
MvaI	CCWGG	5 cut(s)	195, 279, 336, 1688, 2087
MvnI	CGCG	2 cut(s)	2945, 2988
MwoI	GCNNNNNNNGC	6 cut(s)	596, 2036, 2868, 3200, 3216, 3730
NcoI	CCATGG	2 cut(s)	284, 2314
NdeI	CATATG	3 cut(s)	670, 1042, 2469
NheI	GCTAGC	2 cut(s)	1934, 2347
NmuCI	GTSAC	2 cut(s)	824, 943
NsiI	ATGCAT	3 cut(s)	1011, 1622, 3281
NspI	RCATGY	4 cut(s)	779, 1216, 1418, 2101
OliI	CACNNNNGTG	2 cut(s)	1238, 1763
PaeI	GCATGC	1 cut(s)	1418
PagI	TCATGA	1 cut(s)	3157
PceI	AGGCCT	1 cut(s)	2023
PciI	ACATGT	2 cut(s)	775, 1212
PciSI	GCTCTTC	3 cut(s)	1857, 2165, 4050
PcsI	WCGNNNNNNNCGW	3 cut(s)	455, 2336, 2665
PctI	GAATGC	2 cut(s)	2707, 2829
PdmI	GAANNNNTTC	1 cut(s)	1851
PflMI	CCANNNNNTGG	2 cut(s)	1862, 2213
PinAI	ACCGGT	1 cut(s)	1034
PleI	GAGTC	7 cut(s)	886, 1148, 2557, 3448, 3619, 3976, 4105
PpsI	GAGTC	7 cut(s)	886, 1148, 2557, 3448, 3619, 3976, 4105
PpuMI	RGGWCCY	1 cut(s)	2398
PscI	ACATGT	2 cut(s)	775, 1212
PshAI	GACNNNNGTC	2 cut(s)	1158, 3657
PshBI	ATTAAT	1 cut(s)	2898
Psp5II	RGGWCCY	1 cut(s)	2398
Psp6I	CCWGG	5 cut(s)	193, 277, 334, 1686, 2085
PspGI	CCWGG	5 cut(s)	193, 277, 334, 1686, 2085
PspPI	GGNCC	8 cut(s)	281, 332, 707, 2083, 2365, 2398, 2643, 3919
PspPPI	RGGWCCY	1 cut(s)	2398
PstI	CTGCAG	2 cut(s)	582, 2542
PstNI	CAGNNNCTG	3 cut(s)	59, 320, 3014
PsuI	RGATCY	3 cut(s)	565, 1825, 2335
PvuII	CAGCTG	5 cut(s)	122, 839, 1544, 3011, 3576
RseI	CAYNNNNRTG	6 cut(s)	653, 1238, 1497, 1763, 1909, 2145
SacII	CCGCGG	1 cut(s)	2946
SapI	GCTCTTC	3 cut(s)	1857, 2165, 4050
Sau96I	GGNCC	8 cut(s)	281, 332, 707, 2083, 2365, 2398, 2643, 3919
SbfI	CCTGCAGG	1 cut(s)	582
ScaI	AGTACT	1 cut(s)	1279
SchI	GAGTC	7 cut(s)	887, 1148, 2558, 3449, 3620, 3976, 4105
ScrFI	CCNGG	5 cut(s)	195, 279, 336, 1688, 2087
SdaI	CCTGCAGG	1 cut(s)	582
SduI	GDGCHC	4 cut(s)	464, 1695, 3317, 3967
SfcI	CTRYAG	5 cut(s)	578, 2538, 3268, 3435, 3531
Sfr303I	CCGCGG	1 cut(s)	2946
SgrBI	CCGCGG	1 cut(s)	2946
SinI	GGWCC	7 cut(s)	281, 332, 707, 2083, 2365, 2398, 3919
SmiMI	CAYNNNNRTG	6 cut(s)	653, 1238, 1497, 1763, 1909, 2145
SpeI	ACTAGT	1 cut(s)	506
SphI	GCATGC	1 cut(s)	1418
Sse8387I	CCTGCAGG	1 cut(s)	582
SseBI	AGGCCT	1 cut(s)	2023
SspI	AATATT	3 cut(s)	620, 1255, 3043
StuI	AGGCCT	1 cut(s)	2023
StyD4I	CCNGG	5 cut(s)	193, 277, 334, 1686, 2085
StyI	CCWWGG	4 cut(s)	284, 634, 702, 2314
TaiI	ACGT	5 cut(s)	495, 1289, 1657, 2671, 3103
TaqI	TCGA	7 cut(s)	1994, 2326, 2659, 3067, 3337, 3685, 4026
TatI	WGTACW	5 cut(s)	728, 1277, 2760, 3765, 3907
TauI	GCSGC	2 cut(s)	2251, 2862
TseFI	GTSAC	2 cut(s)	824, 943
Tsp45I	GTSAC	2 cut(s)	824, 943
TspGWI	ACGGA	5 cut(s)	447, 479, 576, 1601, 2328
Van91I	CCANNNNNTGG	2 cut(s)	1862, 2213
Vha464I	CTTAAG	1 cut(s)	2012
VneI	GTGCAC	1 cut(s)	460
VpaK11BI	GGWCC	7 cut(s)	281, 332, 707, 2083, 2365, 2398, 3919
VspI	ATTAAT	1 cut(s)	2898
XagI	CCTNNNNNAGG	1 cut(s)	3402
XapI	RAATTY	9 cut(s)	658, 808, 1090, 1135, 1229, 1405, 2786, 2912, 2936
XbaI	TCTAGA	2 cut(s)	751, 2044
XceI	RCATGY	4 cut(s)	779, 1216, 1418, 2101
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1499
XmiI	GTMKAC	1 cut(s)	2310
XmnI	GAANNNNTTC	1 cut(s)	1851
ZrmI	AGTACT	1 cut(s)	1279
Zsp2I	ATGCAT	3 cut(s)	1011, 1622, 3281

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.