Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000182.1

Orthogroup ID

OG0004421

Physical Location & Seq

Genomic Coordinates Forward (+)

41183 .. 49451

Gene Structure 8269 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000182.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 4374 bp

atgcgattgcaatcgacgcgatctgagtcgtcgccgtttctgaattcttcgtcggggtttgatcggaccagggttttacgacagcgcggcggcggaggaggaggagaggaggaggttagggagagttctaattgtggattcgccgccgaggatttcgacggcgaggacatgtcgatcgatctcgatacattctatcgtcttctcgaggaagaacccccgagttgtccggaggattcatcattgggaagcggatcacaggctgaagcagtttcaggtgctgattaccgtgaggatacactgctccaaagtggatcgcaagttttaaaagcagaatcatcagctgatttagggggtttcggatcatggcatcctccatacagctctgaagcttcggattctggggcagggcgtccaggtggttcctttgattatgcagggaaccctgcaatgttctctgactacaaagatagcaaaccaacagcatacactggctctcctggtccatggcatcctccatatatctcagaagcatcagattctgtggcagggggtccaggtggttcctttgagtgtggagggaaccctgcaatgtctattgacaggaaaccaccagcacagaccagctctcatgggcaaatgttccctacaagtcttaaagactggttttcgttggttccgtgcacggagacttacttcactgagagggttgacgtttcacagcccactagtagcaccacttctagttttgaagaaggacatactaatcatgttttagaccacggagatcttaatgtcctgcaggggaaagcagatgtggcagggaaagttgattctgaatattcttcacaaaaccttggtattgataacatggacatgaattccagaccatatggtgctttgggggaaaacaccccagaaaccttgggaccatcggaaaataattcttgtacatctatggaaataccctttctagatatagatatatgttcaccacatgttacttctaccgaatctactctctgtcaaaattctgatcttttcagtgaccattatacagctgcggatggtaggagcttagacaatagatatttggcagagtcctcaatccagcatagtccttatagctactactctacattatttccaagtaacaaagaaatggtgacgaatgtgaaggatgaatcactggagtttcacgctgatagttcatgctcaagcagtaagatgcatatcaattgtcaggagggaataaccggtacatatggctttgattcgccaatgattgatgcttcagatatcaaggagtggaattttgattatggaagatataattgtatttcggctgttagtgggaattcttcattggatgctgactcttgtcctgttgacaacaaggcttcagtcaagcctttgggttctactgagacatacatgtcaagcaaacgggaattcactggtgtgaaggatgaaaatattgatgagttggttgctcctagtactgatacgtttcattctttttcattcatggatgacagtagaaagccatcttacaatgctgatggtagctcttttgacaaggaaccaaagctctcaggttatgatgtatctactcagccttttggaaattcagggcatgctaaagaagagatgattgttgatactaagagaacttattattctgaaggtaatataaatggaagttctttaccccatgttggtggtggatatgtgaatctaaatggtttggaacatcagttgccagctgctcagccattctcttcaaacatgaatcagggttatagtacggacagacttgaggaagatgactatgatgtatgcattattgaagataagagtgatcctgcacccacacgtcgccttccagtggttagcaatactcgttacctggagcccttgaatcgctctctagcagttggaagtaacatcgttaattcacaacaatctagtgatcacgacacaggagtgggaggcataccattcaggacaagggaggagcaattgatcttgagagtagcattgcaggatctttcacagcccaagtcagaagctcttccaccagatggagttttaacagtacctctcttacgacatcagagaatcgcattgtcatggatggttcagaaggagacagctagcttgccttgttgcggaggaatacttgcagatgatcagggattgggaaaaacgatatcgacaattgcactcatacttaaggaaaggcctcctgcttctggagcctgtctagatgaaaaaaagtgcaagctagaaactctggatttggaccaggatgatgacatgcttcctgaggttagcagaaggaagcaagatgctgatgctcattcaagtgtctcaaatgaaacttctgagaagagcatgacatctttgatacaaacaaagggaaggccagcttgtggaacactcgttgtttgtcccaccagtgtcttgcggcaatgggcagaggagttgcgtaataaaataacagaaaaagctaaactctcagtgctagtctaccatggaggcaatcgaacgagggatccgtgtgagctagctaagtatgatgtggtcctcacaacatattcaattgtcagcatggaggtcccaaagcagcctcttgctgatggagaagatgaggagaaaggaaagcgagaggagtatgattctccacatatggggttttcatctaagaaaaggaaatatcctaataaatgctcaaagggtaagaagggattggagactgcagcgcttgagtctcttgctcgccctcttgctaaggttggatggtttagggttgtcttggatgaagcccagagtattaagaatcacagaactcaagtagctagggcctgttgggggcttcgagcgaaacgtaggtggtgcttatcggggacacctatccagaatgcgattgatgatctttatagctacttcagatttctgagatatgacccttatgcggtgtacaagtcgttttgtgcaaaaataaaatttccaattagtaagaatccagcaaaagggtacagaatgctgcaagctgttctgaagacaattatgttacgccgcacaaaaggcactcttcttgatggagaacctattattaatttaccgccaaaatttatagaactgaaaagggtggaattctccgcggaagaacgagatttttactcaaggctagagagtgattcacgcgctcaatttgaagaatatgcagctgctggaactgtgaaacaaaattatgttaatattttattgatgctcttgcgacttcgacaagcttgtgatcaccctcttcttgtcagacgttatgaatcacagtctttatggaaatcttcggttgagaaggcaaagaagcttactcatgacaaacaagtatcccttctgaattgtttggaagcttctttggcaatatgcggtatctgcaatgatgcacctgaagatgccgttgtttctgaatgtggtcatgtcttctgtagccaatgcatttttgactatctcactggtgatgacaaccagtgccccaacacaagttgcaaagttcgactgaatgtgtcttctgtcttttcaaaagccactttaaacagttcgctttctgaccaacctagtcaagggggcatgggttctgaagtttttgatgctgtagagtctttctatgaggatagctcgtacaattcatccaagattaaggctgcacttgaggttctctgcttgatgtgtaaaccaaagacttgcactacagaaaatagttgcttaccagaaagcgttgataaaaatgccagctgttctacaacgtcttttgacattgatggggctgagtcccttgaggacagttctgatggacagaacttgggtgtggacaaaagtcctaagaaaattgagaaggtagttcgagaaaaagcaatagtcttttcacagtggactaggatgctggacttgcttgaagcgtgtcttaaaacttccggccttgagtacagaagacttgatggaacaatgtcagttgttgccagagataaagctgtaaaggattttaacactcttcctgaggtgtcagttatgattatgtctttgaaagctgctagtcttggtctgaacatggttgcagcctgccatgtacttcttttggacctgtggtggaatcctacgactgaagatcaagcaattgatagagcacatcgtattgggcagactcgtcctgttacggttttacggttgactgtgagagatacggtcgaagatcgtattttagctcttcagaaaaagaagagagagatggtggcatctgcatttggagaggatgagactggtggtcgtcagactcgcttaacagttgatgatctcaagtacctgtttatgaagtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000724 GO:0000725 GO:0006139 GO:0006259 GO:0006281 GO:0006302 GO:0006310 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009292 GO:0009294 GO:0009987 GO:0033554 GO:0034641 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0044764 GO:0045003 GO:0046483 GO:0050896 GO:0051704 GO:0051716 GO:0071704 GO:0090304 GO:1901360

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Helicase_C SNF2_N zf-C3HC4 zf-C3HC4_2

Protein Analysis

1457

Amino Acids

160.38

Weight (kDa)

5.1

Isoelectric Point (pI)

55.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004421)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11100 AT1G11100 AT1G11100 AT1G11100 AT1G11100 AT1G61140 AT1G61140 AT1G61140
fragaria_vesca	FvH4_3g04580 FvH4_3g04580 FvH4_3g04580 FvH4_3g04580 FvH4_3g04580
malus_domestica	MD05G1322200.v1.1 MD10G1300200.v1.1
prunus_persica	Prupe.4G040600_v2.0.a1 Prupe.4G040600_v2.0.a1
pyrus_communis	pycom05g29650 pycom10g25290
rosa_chinensis	RchiOBHm_Chr5g0007521
rosa_laevigata	RLG00000031464
rosa_multiflora	Rmu_co8522595.1_g000001 Rmu_ssc0000182.1_g000011
rosa_roxburghii	Rroxscaffold_1G00068890
rosa_rugosa	Rorug04G0427800 Rorug04G0427900 Rorug04G0428000
rosa_samantha	Rh5AG055800 Rh5BG053400 Rh5CG063200 Rh5DG052400
rosa_wichuraiana	Rw5G005420

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1432
AccB7I	CCANNNNNTGG	2 cut(s)	2081, 2432
AccI	GTMKAC	1 cut(s)	2529
AccII	CGCG	4 cut(s)	19, 87, 3164, 3207
AccIII	TCCGGA	1 cut(s)	226
AclWI	GGATC	7 cut(s)	259, 319, 367, 1853, 2052, 2549, 2562
AcyI	GRCGYC	1 cut(s)	409
AfeI	AGCGCT	1 cut(s)	2763
AflII	CTTAAG	1 cut(s)	2231
AflIII	ACRYGT	4 cut(s)	168, 994, 1431, 1871
AgeI	ACCGGT	1 cut(s)	1253
AhdI	GACNNNNNGTC	1 cut(s)	4320
AhlI	ACTAGT	1 cut(s)	725
AjiI	CACGTC	1 cut(s)	1874
AjnI	CCWGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
AjuI	GAANNNNNNNTTGG	2 cut(s)	1346, 1378
AleI	CACNNNNGTG	2 cut(s)	1457, 1982
AloI	GAACNNNNNNTCC	2 cut(s)	2539, 2571
Alw21I	GWGCWC	2 cut(s)	683, 4186
Alw26I	GTCTC	7 cut(s)	680, 1418, 2141, 2374, 2747, 2775, 4307
Alw44I	GTGCAC	1 cut(s)	679
AlwI	GGATC	7 cut(s)	259, 319, 367, 1853, 2052, 2549, 2562
AlwNI	CAGNNNCTG	3 cut(s)	278, 539, 3233
Ama87I	CYCGRG	2 cut(s)	203, 217
Aor13HI	TCCGGA	1 cut(s)	226
Aor51HI	AGCGCT	1 cut(s)	2763
AoxI	GGCC	4 cut(s)	2240, 2423, 2862, 3976
ApaLI	GTGCAC	1 cut(s)	679
AseI	ATTAAT	1 cut(s)	3117
AsiGI	ACCGGT	1 cut(s)	1253
Asp700I	GAANNNNTTC	1 cut(s)	2070
AspLEI	GCGC	3 cut(s)	87, 2764, 3209
AspS9I	GGNCC	9 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 2862, 4138
AsuHPI	GGTGA	4 cut(s)	981, 1174, 3293, 3530
AsuNHI	GCTAGC	2 cut(s)	2153, 2566
AvaI	CYCGRG	2 cut(s)	203, 217
AvaII	GGWCC	8 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 4138
AxyI	CCTNAGG	2 cut(s)	2325, 4056
BaeGI	GKGCMC	2 cut(s)	683, 3536
BamHI	GGATCC	1 cut(s)	2554
BanII	GRGCYC	1 cut(s)	1914
BarI	GAAGNNNNNNTAC	2 cut(s)	721, 753
BbsI	GAAGAC	5 cut(s)	191, 3068, 3475, 3561, 3997
Bbv12I	GWGCWC	2 cut(s)	683, 4186
BceAI	ACGGC	3 cut(s)	19, 175, 3443
BciT130I	CCWGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
BciVI	GTATCC	2 cut(s)	286, 3400
BclI	TGATCA	3 cut(s)	1969, 2188, 3298
BcoDI	GTCTC	7 cut(s)	680, 1418, 2141, 2374, 2747, 2775, 4307
BcuI	ACTAGT	1 cut(s)	725
BfmI	CTRYAG	5 cut(s)	797, 2757, 3487, 3654, 3750
BfoI	RGCGCY	1 cut(s)	2765
BfrI	CTTAAG	1 cut(s)	2231
BfuI	GTATCC	2 cut(s)	286, 3400
BglII	AGATCT	1 cut(s)	784
BlpI	GCTNAGC	1 cut(s)	1767
BmcAI	AGTACT	1 cut(s)	1498
Bme1390I	CCNGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
Bme18I	GGWCC	8 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 4138
BmeRI	GACNNNNNGTC	1 cut(s)	4320
BmeT110I	CYCGRG	2 cut(s)	203, 217
BmgBI	CACGTC	1 cut(s)	1874
BmgT120I	GGNCC	9 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 2862, 4138
BmrFI	CCNGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
BmtI	GCTAGC	2 cut(s)	2157, 2570
BoxI	GACNNNNGTC	2 cut(s)	1377, 3876
BpiI	GAAGAC	5 cut(s)	191, 3068, 3475, 3561, 3997
BplI	GAGNNNNNCTC	2 cut(s)	3662, 3694
BpmI	CTGGAG	3 cut(s)	1208, 1928, 2274
Bpu10I	CCTNAGC	1 cut(s)	2790
Bpu1102I	GCTNAGC	1 cut(s)	1767
Bsa29I	ATCGAT	1 cut(s)	177
BsaBI	GATNNNNATC	2 cut(s)	10, 1229
BsaHI	GRCGYC	1 cut(s)	409
BsaJI	CCNNGG	8 cut(s)	69, 147, 503, 778, 853, 921, 2533, 3162
BsaWI	WCCGGW	2 cut(s)	226, 1253
BsaXI	ACNNNNNCTCC	2 cut(s)	478, 508
Bse118I	RCCGGY	1 cut(s)	1253
Bse1I	ACTGG	9 cut(s)	493, 665, 1191, 1459, 1883, 2457, 3520, 3529, 4321
Bse21I	CCTNAGG	2 cut(s)	2325, 4056
Bse3DI	GCAATG	5 cut(s)	453, 594, 2036, 2477, 3445
Bse8I	GATNNNNATC	2 cut(s)	10, 1229
BseAI	TCCGGA	1 cut(s)	226
BseBI	CCWGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
BseCI	ATCGAT	1 cut(s)	177
BseDI	CCNNGG	8 cut(s)	69, 147, 503, 778, 853, 921, 2533, 3162
BseJI	GATNNNNATC	2 cut(s)	10, 1229
BseMI	GCAATG	5 cut(s)	453, 594, 2036, 2477, 3445
BseNI	ACTGG	9 cut(s)	493, 665, 1191, 1459, 1883, 2457, 3520, 3529, 4321
BseRI	GAGGAG	9 cut(s)	111, 114, 117, 122, 125, 2027, 2495, 2666, 2684
BseSI	GKGCMC	2 cut(s)	683, 3536
BsgI	GTGCAG	2 cut(s)	1848, 3690
Bsh1236I	CGCG	4 cut(s)	19, 87, 3164, 3207
Bsh1285I	CGRYCG	2 cut(s)	177, 4245
BshFI	GGCC	4 cut(s)	2242, 2425, 2864, 3978
BshTI	ACCGGT	1 cut(s)	1253
BshVI	ATCGAT	1 cut(s)	177
BsiEI	CGRYCG	2 cut(s)	177, 4245
BsiHKAI	GWGCWC	2 cut(s)	683, 4186
BsiHKCI	CYCGRG	2 cut(s)	203, 217
BsiSI	CCGG	3 cut(s)	227, 1254, 3975
BslFI	GGGAC	5 cut(s)	939, 2436, 2603, 2920, 3817
BsmAI	GTCTC	7 cut(s)	680, 1418, 2141, 2374, 2747, 2775, 4307
BsmFI	GGGAC	5 cut(s)	939, 2436, 2603, 2920, 3817
BsmI	GAATGC	2 cut(s)	2926, 3048
BsnI	GGCC	4 cut(s)	2242, 2425, 2864, 3978
BsoBI	CYCGRG	2 cut(s)	203, 217
Bsp1286I	GDGCHC	4 cut(s)	683, 1914, 3536, 4186
Bsp13I	TCCGGA	1 cut(s)	226
Bsp1407I	TGTACA	2 cut(s)	947, 2979
Bsp1720I	GCTNAGC	1 cut(s)	1767
Bsp19I	CCATGG	2 cut(s)	503, 2533
BspANI	GGCC	4 cut(s)	2242, 2425, 2864, 3978
BspDI	ATCGAT	1 cut(s)	177
BspEI	TCCGGA	1 cut(s)	226
BspFNI	CGCG	4 cut(s)	19, 87, 3164, 3207
BspHI	TCATGA	1 cut(s)	3376
BspMAI	CTGCAG	2 cut(s)	801, 2761
BspOI	GCTAGC	2 cut(s)	2157, 2570
BspPI	GGATC	7 cut(s)	259, 319, 367, 1853, 2052, 2549, 2562
BspQI	GCTCTTC	3 cut(s)	2076, 2384, 4269
BspTI	CTTAAG	1 cut(s)	2231
BsrDI	GCAATG	5 cut(s)	453, 594, 2036, 2477, 3445
BsrFI	RCCGGY	1 cut(s)	1253
BsrGI	TGTACA	2 cut(s)	947, 2979
BsrI	ACTGG	9 cut(s)	493, 665, 1191, 1459, 1883, 2457, 3520, 3529, 4321
BssAI	RCCGGY	1 cut(s)	1253
BssECI	CCNNGG	8 cut(s)	69, 147, 503, 778, 853, 921, 2533, 3162
BssNI	GRCGYC	1 cut(s)	409
BssT1I	CCWWGG	4 cut(s)	503, 853, 921, 2533
Bst2UI	CCWGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
Bst6I	CTCTTC	9 cut(s)	1638, 1783, 2076, 2384, 3099, 3312, 4056, 4269, 4271
BstACI	GRCGYC	1 cut(s)	409
BstAFI	CTTAAG	1 cut(s)	2231
BstAUI	TGTACA	2 cut(s)	947, 2979
BstDSI	CCRYGG	4 cut(s)	503, 778, 2533, 3162
BstENI	CCTNNNNNAGG	1 cut(s)	3621
BstFNI	CGCG	4 cut(s)	19, 87, 3164, 3207
BstH2I	RGCGCY	1 cut(s)	2765
BstHHI	GCGC	3 cut(s)	87, 2764, 3209
BstMAI	GTCTC	7 cut(s)	680, 1418, 2141, 2374, 2747, 2775, 4307
BstMCI	CGRYCG	2 cut(s)	177, 4245
BstMWI	GCNNNNNNNGC	7 cut(s)	16, 815, 2255, 3087, 3419, 3435, 3949
BstNI	CCWGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
BstNSI	RCATGY	5 cut(s)	172, 998, 1435, 1637, 2320
BstPAI	GACNNNNGTC	2 cut(s)	1377, 3876
BstSCI	CCNGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
BstSFI	CTRYAG	5 cut(s)	797, 2757, 3487, 3654, 3750
BstSLI	GKGCMC	2 cut(s)	683, 3536
BstUI	CGCG	4 cut(s)	19, 87, 3164, 3207
BstV2I	GAAGAC	5 cut(s)	191, 3068, 3475, 3561, 3997
BstX2I	RGATCY	3 cut(s)	784, 2044, 2554
BstXI	CCANNNNNNTGG	1 cut(s)	1718
BstYI	RGATCY	3 cut(s)	784, 2044, 2554
Bsu15I	ATCGAT	1 cut(s)	177
Bsu36I	CCTNAGG	2 cut(s)	2325, 4056
BsuI	GTATCC	2 cut(s)	286, 3400
BsuRI	GGCC	4 cut(s)	2242, 2425, 2864, 3978
BsuTUI	ATCGAT	1 cut(s)	177
BtgI	CCRYGG	4 cut(s)	503, 778, 2533, 3162
BtrI	CACGTC	1 cut(s)	1874
BtsI	GCAGTG	1 cut(s)	296
CaiI	CAGNNNCTG	3 cut(s)	278, 539, 3233
CciI	TCATGA	1 cut(s)	3376
CfoI	GCGC	3 cut(s)	87, 2764, 3209
Cfr10I	RCCGGY	1 cut(s)	1253
Cfr13I	GGNCC	9 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 2862, 4138
Cfr42I	CCGCGG	1 cut(s)	3165
ClaI	ATCGAT	1 cut(s)	177
CseI	GACGC	2 cut(s)	25, 398
CspAI	ACCGGT	1 cut(s)	1253
DraI	TTTAAA	2 cut(s)	324, 3594
DrdI	GACNNNNNNGTC	1 cut(s)	1432
DriI	GACNNNNNGTC	1 cut(s)	4320
DseDI	GACNNNNNNGTC	1 cut(s)	1432
Eam1104I	CTCTTC	9 cut(s)	1638, 1783, 2076, 2384, 3099, 3312, 4056, 4269, 4271
Eam1105I	GACNNNNNGTC	1 cut(s)	4320
EarI	CTCTTC	9 cut(s)	1638, 1783, 2076, 2384, 3099, 3312, 4056, 4269, 4271
EciI	GGCGGA	1 cut(s)	108
Eco130I	CCWWGG	4 cut(s)	503, 853, 921, 2533
Eco147I	AGGCCT	1 cut(s)	2242
Eco24I	GRGCYC	1 cut(s)	1914
Eco32I	GATATC	2 cut(s)	1297, 2211
Eco47I	GGWCC	8 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 4138
Eco47III	AGCGCT	1 cut(s)	2763
Eco81I	CCTNAGG	2 cut(s)	2325, 4056
Eco88I	CYCGRG	2 cut(s)	203, 217
EcoNI	CCTNNNNNAGG	1 cut(s)	3621
EcoO109I	RGGNCCY	2 cut(s)	2617, 2862
EcoRI	GAATTC	5 cut(s)	43, 877, 1354, 1448, 3155
EcoRII	CCWGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
EcoRV	GATATC	2 cut(s)	1297, 2211
EcoT14I	CCWWGG	4 cut(s)	503, 853, 921, 2533
EcoT22I	ATGCAT	3 cut(s)	1230, 1841, 3500
EcoT38I	GRGCYC	1 cut(s)	1914
ErhI	CCWWGG	4 cut(s)	503, 853, 921, 2533
FalI	AAGNNNNNCTT	8 cut(s)	2413, 2445, 3078, 3110, 3378, 3410, 3948, 3980
FaqI	GGGAC	5 cut(s)	939, 2436, 2603, 2920, 3817
FauNDI	CATATG	3 cut(s)	889, 1261, 2688
FbaI	TGATCA	3 cut(s)	1969, 2188, 3298
FblI	GTMKAC	1 cut(s)	2529
FriOI	GRGCYC	1 cut(s)	1914
GlaI	GCGC	3 cut(s)	86, 2763, 3208
GsuI	CTGGAG	3 cut(s)	1208, 1928, 2274
HaeII	RGCGCY	1 cut(s)	2765
HaeIII	GGCC	4 cut(s)	2242, 2425, 2864, 3978
HapII	CCGG	3 cut(s)	227, 1254, 3975
HgaI	GACGC	2 cut(s)	25, 398
HhaI	GCGC	3 cut(s)	87, 2764, 3209
Hin1I	GRCGYC	1 cut(s)	409
Hin6I	GCGC	3 cut(s)	85, 2762, 3207
HinP1I	GCGC	3 cut(s)	85, 2762, 3207
HincII	GTYRAC	3 cut(s)	709, 1387, 4227
HindII	GTYRAC	3 cut(s)	709, 1387, 4227
HindIII	AAGCTT	4 cut(s)	387, 3291, 3368, 3411
HpaII	CCGG	3 cut(s)	227, 1254, 3975
HphI	GGTGA	4 cut(s)	981, 1174, 3293, 3530
Hpy99I	CGWCG	5 cut(s)	19, 34, 55, 161, 1878
HpyCH4IV	ACGT	6 cut(s)	711, 1505, 1873, 2887, 3319, 3806
HpyF10VI	GCNNNNNNNGC	7 cut(s)	16, 815, 2255, 3087, 3419, 3435, 3949
HpySE526I	ACGT	6 cut(s)	711, 1505, 1873, 2887, 3319, 3806
Hsp92I	GRCGYC	1 cut(s)	409
HspAI	GCGC	3 cut(s)	85, 2762, 3207
Kpn2I	TCCGGA	1 cut(s)	226
Ksp22I	TGATCA	3 cut(s)	1969, 2188, 3298
KspI	CCGCGG	1 cut(s)	3165
LguI	GCTCTTC	3 cut(s)	2076, 2384, 4269
LmnI	GCTCC	6 cut(s)	306, 1071, 1495, 1909, 2014, 2255
MaeII	ACGT	6 cut(s)	711, 1505, 1873, 2887, 3319, 3806
MaeIII	GTNAC	8 cut(s)	997, 1043, 1148, 1162, 1901, 1940, 3072, 4210
MfeI	CAATTG	5 cut(s)	1234, 2018, 2217, 2601, 4173
MflI	RGATCY	3 cut(s)	784, 2044, 2554
MhlI	GDGCHC	4 cut(s)	683, 1914, 3536, 4186
MlyI	GAGTC	8 cut(s)	35, 1106, 1367, 2777, 3668, 3839, 4195, 4324
MmeI	TCCRAC	2 cut(s)	1915, 2776
Mph1103I	ATGCAT	3 cut(s)	1230, 1841, 3500
MroI	TCCGGA	1 cut(s)	226
MroXI	GAANNNNTTC	1 cut(s)	2070
MslI	CAYNNNNRTG	6 cut(s)	872, 1457, 1716, 1982, 2128, 2364
MspA1I	CMGCKG	6 cut(s)	341, 1058, 1763, 3164, 3230, 3795
MspCI	CTTAAG	1 cut(s)	2231
MspI	CCGG	3 cut(s)	227, 1254, 3975
MspR9I	CCNGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
MunI	CAATTG	5 cut(s)	1234, 2018, 2217, 2601, 4173
Mva1269I	GAATGC	2 cut(s)	2926, 3048
MvaI	CCWGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
MvnI	CGCG	4 cut(s)	19, 87, 3164, 3207
MwoI	GCNNNNNNNGC	7 cut(s)	16, 815, 2255, 3087, 3419, 3435, 3949
NcoI	CCATGG	2 cut(s)	503, 2533
NdeI	CATATG	3 cut(s)	889, 1261, 2688
NheI	GCTAGC	2 cut(s)	2153, 2566
NmeAIII	GCCGAG	1 cut(s)	172
NmuCI	GTSAC	2 cut(s)	1043, 1162
NsiI	ATGCAT	3 cut(s)	1230, 1841, 3500
NspI	RCATGY	5 cut(s)	172, 998, 1435, 1637, 2320
OliI	CACNNNNGTG	2 cut(s)	1457, 1982
PaeI	GCATGC	1 cut(s)	1637
PaeR7I	CTCGAG	1 cut(s)	203
PagI	TCATGA	1 cut(s)	3376
PceI	AGGCCT	1 cut(s)	2242
PciI	ACATGT	3 cut(s)	168, 994, 1431
PciSI	GCTCTTC	3 cut(s)	2076, 2384, 4269
PcsI	WCGNNNNNNNCGW	3 cut(s)	674, 2555, 2884
PctI	GAATGC	2 cut(s)	2926, 3048
PdmI	GAANNNNTTC	1 cut(s)	2070
PflMI	CCANNNNNTGG	2 cut(s)	2081, 2432
PinAI	ACCGGT	1 cut(s)	1253
Ple19I	CGATCG	1 cut(s)	177
PleI	GAGTC	8 cut(s)	34, 1105, 1367, 2776, 3667, 3838, 4195, 4324
PpsI	GAGTC	8 cut(s)	34, 1105, 1367, 2776, 3667, 3838, 4195, 4324
PpuMI	RGGWCCY	1 cut(s)	2617
PscI	ACATGT	3 cut(s)	168, 994, 1431
PshAI	GACNNNNGTC	2 cut(s)	1377, 3876
PshBI	ATTAAT	1 cut(s)	3117
Psp5II	RGGWCCY	1 cut(s)	2617
Psp6I	CCWGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
PspGI	CCWGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
PspPI	GGNCC	9 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 2862, 4138
PspPPI	RGGWCCY	1 cut(s)	2617
PstI	CTGCAG	2 cut(s)	801, 2761
PstNI	CAGNNNCTG	3 cut(s)	278, 539, 3233
PsuI	RGATCY	3 cut(s)	784, 2044, 2554
PvuI	CGATCG	1 cut(s)	177
PvuII	CAGCTG	5 cut(s)	341, 1058, 1763, 3230, 3795
RseI	CAYNNNNRTG	6 cut(s)	872, 1457, 1716, 1982, 2128, 2364
SacII	CCGCGG	1 cut(s)	3165
SapI	GCTCTTC	3 cut(s)	2076, 2384, 4269
Sau96I	GGNCC	9 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 2862, 4138
SbfI	CCTGCAGG	1 cut(s)	801
ScaI	AGTACT	1 cut(s)	1498
SchI	GAGTC	8 cut(s)	35, 1106, 1367, 2777, 3668, 3839, 4195, 4324
ScrFI	CCNGG	6 cut(s)	70, 414, 498, 555, 1907, 2306
SdaI	CCTGCAGG	1 cut(s)	801
SduI	GDGCHC	4 cut(s)	683, 1914, 3536, 4186
SfcI	CTRYAG	5 cut(s)	797, 2757, 3487, 3654, 3750
Sfr274I	CTCGAG	1 cut(s)	203
Sfr303I	CCGCGG	1 cut(s)	3165
SgrBI	CCGCGG	1 cut(s)	3165
SinI	GGWCC	8 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 4138
SlaI	CTCGAG	1 cut(s)	203
SmiMI	CAYNNNNRTG	6 cut(s)	872, 1457, 1716, 1982, 2128, 2364
SpeI	ACTAGT	1 cut(s)	725
SphI	GCATGC	1 cut(s)	1637
Sse8387I	CCTGCAGG	1 cut(s)	801
SseBI	AGGCCT	1 cut(s)	2242
SspI	AATATT	3 cut(s)	839, 1474, 3262
StuI	AGGCCT	1 cut(s)	2242
StyD4I	CCNGG	6 cut(s)	68, 412, 496, 553, 1905, 2304
StyI	CCWWGG	4 cut(s)	503, 853, 921, 2533
TaiI	ACGT	6 cut(s)	714, 1508, 1876, 2890, 3322, 3809
TatI	WGTACW	5 cut(s)	947, 1496, 2979, 3984, 4126
TauI	GCSGC	5 cut(s)	90, 93, 146, 2470, 3081
TseFI	GTSAC	2 cut(s)	1043, 1162
Tsp45I	GTSAC	2 cut(s)	1043, 1162
TspGWI	ACGGA	5 cut(s)	666, 698, 795, 1820, 2547
Van91I	CCANNNNNTGG	2 cut(s)	2081, 2432
Vha464I	CTTAAG	1 cut(s)	2231
VneI	GTGCAC	1 cut(s)	679
VpaK11BI	GGWCC	8 cut(s)	66, 500, 551, 926, 2302, 2584, 2617, 4138
VspI	ATTAAT	1 cut(s)	3117
XagI	CCTNNNNNAGG	1 cut(s)	3621
XbaI	TCTAGA	2 cut(s)	970, 2263
XceI	RCATGY	5 cut(s)	172, 998, 1435, 1637, 2320
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1718
XhoI	CTCGAG	1 cut(s)	203
XmiI	GTMKAC	1 cut(s)	2529
XmnI	GAANNNNTTC	1 cut(s)	2070
ZrmI	AGTACT	1 cut(s)	1498
Zsp2I	ATGCAT	3 cut(s)	1230, 1841, 3500

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.