Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000066.1

Orthogroup ID

OG0013525

Physical Location & Seq

Genomic Coordinates Reverse (-)

74552 .. 75960

Gene Structure 1409 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000066.1_g000016.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1056 bp

atggaggtttctggattagtttcccgccaagttccatgcttttccggtgccggaatcgatacccggtcttcaaattcatcgttttccggcgacgtccactttccgggtcgtaatgaatttggagtgagtctgaggacccgaagggctatgaattctgggttttgtgataaggggcatgtggagtattattattcggttcccagatgcggtggtaataagaaggagaaggagatcaagaagaaattgaagttgcttaaaggattggcggagctgtctgcgtcttctcagattagtactgggttggattccgaggagggtttggctgctcaagttcaggggaagctgatttcggaaggtgcagaagcattgctacagcaattggaacagctaagagctgaggagaaggagttgaagaaaaagaagaaagaagagaaggcgaggcttaaggcagagcggatgaataccatgaaggactgtgaatcgtcatcttcatcgtcgtcatctgagtcgagtgagagtgaatgtggggaggtggttgacatgaacagcctgagaggtgaggtccctgcgcaaccgatactagagggtttgcagccatcgacccaaggaggggtggcattattgacccagccgagttcggtaaccacacttcaagaagataaatgctgcactggaactagtactagttgtggcagcagtgatagtattggtcctaacaatgcgactagtagctcagttatggaagcatctgttgtgacgaagattgaagtatgcatgggcaaaaagtgcaagacatcaggaggtgtagccttgttggaagaattcgagaggttgatgggtgtcgaaggaagtgttgttgggtgcaagtgtatgggaaaatgcaaaaatggtccaaatgtgagggttttgaattctctggatgaaggaacagaggactctgtaaggaatcccactaatcctttgtacattggagtgggactggaagatgtgagcctcatcgtggccaacttaatgggggaagtcaagaaggatttggggcttgccactgcaacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004144 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006629 GO:0006638 GO:0006639 GO:0006641 GO:0008150 GO:0008152 GO:0008374 GO:0008610 GO:0009058 GO:0009987 GO:0016411 GO:0016740 GO:0016746 GO:0016747 GO:0019432 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044424 GO:0044444 GO:0044464 GO:0045017 GO:0046460 GO:0046463 GO:0046486 GO:0071704 GO:1901576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

351

Amino Acids

37.25

Weight (kDa)

5.6

Isoelectric Point (pI)

45.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013525)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48300
fragaria_vesca	FvH4_4g21650 FvH4_4g21660
malus_domestica	MD13G1156700.v1.1 MD16G1134300.v1.1
prunus_persica	Prupe.1G103600_v2.0.a1 Prupe.1G103600_v2.0.a1
pyrus_communis	pycom13g12050 pycom16g11860
rosa_chinensis	RchiOBHm_Chr4g0427881
rosa_multiflora	Rmu_co8387153.1_g000001 Rmu_sc0000066.1_g000016
rosa_roxburghii	Rroxscaffold_5G00369530
rosa_rugosa	Rorug04G0220200
rosa_samantha	Rh4AG277200 Rh4BG283000 Rh4DG280100
rosa_wichuraiana	Rw4G024080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	96
Acc16I	TGCGCA	1 cut(s)	570
AccB1I	GGYRCC	1 cut(s)	47
AccBSI	CCGCTC	1 cut(s)	454
AciI	CCGC	4 cut(s)	25, 207, 266, 454
AcoI	YGGCCR	1 cut(s)	1002
AcsI	RAATTY	5 cut(s)	73, 116, 151, 821, 910
AcyI	GRCGYC	1 cut(s)	93
AfaI	GTAC	3 cut(s)	295, 682, 965
AfiI	CCNNNNNNNGG	5 cut(s)	103, 206, 609, 610, 1000
AflII	CTTAAG	1 cut(s)	443
AgsI	TTSAA	6 cut(s)	72, 247, 412, 653, 767, 910
AhlI	ACTAGT	3 cut(s)	677, 683, 725
AluBI	AGCT	5 cut(s)	271, 343, 388, 395, 732
AluI	AGCT	5 cut(s)	271, 343, 388, 395, 732
AoxI	GGCC	1 cut(s)	1002
ApeKI	GCWGC	4 cut(s)	323, 592, 666, 693
ApoI	RAATTY	5 cut(s)	73, 116, 151, 821, 910
AspLEI	GCGC	1 cut(s)	571
AspS9I	GGNCC	4 cut(s)	135, 562, 710, 890
AsuC2I	CCSGG	2 cut(s)	64, 105
AsuHPI	GGTGA	1 cut(s)	569
AvaII	GGWCC	4 cut(s)	135, 562, 710, 890
BalI	TGGCCA	1 cut(s)	1004
BanI	GGYRCC	1 cut(s)	47
BarI	GAAGNNNNNNTAC	4 cut(s)	354, 386, 633, 665
BbsI	GAAGAC	2 cut(s)	60, 273
BbvCI	CCTCAGC	1 cut(s)	396
BbvI	GCAGC	4 cut(s)	310, 604, 653, 705
BccI	CCATC	2 cut(s)	604, 829
BcnI	CCSGG	2 cut(s)	64, 105
BcuI	ACTAGT	3 cut(s)	677, 683, 725
BfaI	CTAG	4 cut(s)	581, 678, 684, 726
BfmI	CTRYAG	1 cut(s)	371
BfrI	CTTAAG	1 cut(s)	443
BisI	GCNGC	4 cut(s)	324, 593, 667, 694
BlsI	GCNGC	4 cut(s)	325, 594, 668, 695
BmcAI	AGTACT	2 cut(s)	295, 682
Bme1390I	CCNGG	2 cut(s)	64, 105
Bme18I	GGWCC	4 cut(s)	135, 562, 710, 890
BmgT120I	GGNCC	4 cut(s)	135, 562, 710, 890
BmiI	GGNNCC	4 cut(s)	49, 137, 198, 564
BmrFI	CCNGG	2 cut(s)	64, 105
BmrI	ACTGGG	1 cut(s)	306
BmsI	GCATC	2 cut(s)	194, 755
BmuI	ACTGGG	1 cut(s)	306
BpiI	GAAGAC	2 cut(s)	60, 273
Bpu10I	CCTNAGC	1 cut(s)	396
BpuEI	CTTGAG	1 cut(s)	312
BpuMI	CCSGG	2 cut(s)	64, 105
Bsa29I	ATCGAT	1 cut(s)	57
BsaHI	GRCGYC	1 cut(s)	93
BsaJI	CCNNGG	2 cut(s)	309, 604
BsaWI	WCCGGW	1 cut(s)	44
BsaXI	ACNNNNNCTCC	2 cut(s)	392, 422
Bsc4I	CCNNNNNNNGG	5 cut(s)	103, 206, 609, 610, 1000
Bse1I	ACTGG	3 cut(s)	301, 676, 984
Bse3DI	GCAATG	1 cut(s)	365
BseCI	ATCGAT	1 cut(s)	57
BseDI	CCNNGG	2 cut(s)	309, 604
BseGI	GGATG	2 cut(s)	462, 925
BseLI	CCNNNNNNNGG	5 cut(s)	103, 206, 609, 610, 1000
BseMI	GCAATG	1 cut(s)	365
BseMII	CTCAG	6 cut(s)	122, 299, 387, 495, 542, 747
BseNI	ACTGG	3 cut(s)	301, 676, 984
BseRI	GAGGAG	2 cut(s)	326, 413
BseXI	GCAGC	4 cut(s)	310, 604, 653, 705
BseYI	CCCAGC	1 cut(s)	627
BsgI	GTGCAG	2 cut(s)	378, 652
BshFI	GGCC	1 cut(s)	1004
BshNI	GGYRCC	1 cut(s)	47
BshVI	ATCGAT	1 cut(s)	57
BsiSI	CCGG	5 cut(s)	45, 51, 64, 87, 104
BslFI	GGGAC	2 cut(s)	548, 990
BslI	CCNNNNNNNGG	5 cut(s)	103, 206, 609, 610, 1000
BsmFI	GGGAC	2 cut(s)	548, 990
BsnI	GGCC	1 cut(s)	1004
Bsp1407I	TGTACA	1 cut(s)	963
Bsp143I	GATC	1 cut(s)	231
BspACI	CCGC	4 cut(s)	25, 207, 266, 454
BspANI	GGCC	1 cut(s)	1004
BspCNI	CTCAG	6 cut(s)	123, 298, 388, 496, 543, 746
BspDI	ATCGAT	1 cut(s)	57
BspLI	GGNNCC	4 cut(s)	49, 137, 198, 564
BspT107I	GGYRCC	1 cut(s)	47
BspTI	CTTAAG	1 cut(s)	443
BsrBI	CCGCTC	1 cut(s)	454
BsrDI	GCAATG	1 cut(s)	365
BsrGI	TGTACA	1 cut(s)	963
BsrI	ACTGG	3 cut(s)	301, 676, 984
BssECI	CCNNGG	2 cut(s)	309, 604
BssMI	GATC	1 cut(s)	231
BssNI	GRCGYC	1 cut(s)	93
BssT1I	CCWWGG	1 cut(s)	604
Bst4CI	ACNGT	1 cut(s)	476
Bst6I	CTCTTC	1 cut(s)	423
BstACI	GRCGYC	1 cut(s)	93
BstAFI	CTTAAG	1 cut(s)	443
BstAPI	GCANNNNNTGC	1 cut(s)	786
BstAUI	TGTACA	1 cut(s)	963
BstC8I	GCNNGC	1 cut(s)	1041
BstDEI	CTNAG	8 cut(s)	131, 285, 389, 396, 504, 551, 733, 1053
BstEII	GGTNACC	1 cut(s)	640
BstF5I	GGATG	2 cut(s)	462, 925
BstHHI	GCGC	1 cut(s)	571
BstKTI	GATC	1 cut(s)	234
BstMBI	GATC	1 cut(s)	231
BstMWI	GCNNNNNNNGC	1 cut(s)	786
BstNSI	RCATGY	1 cut(s)	179
BstPI	GGTNACC	1 cut(s)	640
BstSCI	CCNGG	2 cut(s)	62, 103
BstSFI	CTRYAG	1 cut(s)	371
BstV1I	GCAGC	4 cut(s)	310, 604, 653, 705
BstV2I	GAAGAC	2 cut(s)	60, 273
BstXI	CCANNNNNNTGG	1 cut(s)	1012
Bsu15I	ATCGAT	1 cut(s)	57
BsuRI	GGCC	1 cut(s)	1004
BsuTUI	ATCGAT	1 cut(s)	57
BtsCI	GGATG	2 cut(s)	462, 925
BtsI	GCAGTG	2 cut(s)	703, 1044
BtsIMutI	CAGTG	3 cut(s)	669, 703, 1044
Cac8I	GCNNGC	1 cut(s)	1041
CfoI	GCGC	1 cut(s)	571
Cfr13I	GGNCC	4 cut(s)	135, 562, 710, 890
ClaI	ATCGAT	1 cut(s)	57
CseI	GACGC	1 cut(s)	267
Csp6I	GTAC	3 cut(s)	294, 681, 964
CviAII	CATG	5 cut(s)	36, 176, 466, 541, 775
CviQI	GTAC	3 cut(s)	294, 681, 964
DdeI	CTNAG	8 cut(s)	131, 285, 389, 396, 504, 551, 733, 1053
DpnI	GATC	1 cut(s)	233
DpnII	GATC	1 cut(s)	231
EaeI	YGGCCR	1 cut(s)	1002
Eam1104I	CTCTTC	1 cut(s)	423
EarI	CTCTTC	1 cut(s)	423
EciI	GGCGGA	1 cut(s)	281
Eco130I	CCWWGG	1 cut(s)	604
Eco47I	GGWCC	4 cut(s)	135, 562, 710, 890
Eco91I	GGTNACC	1 cut(s)	640
EcoO109I	RGGNCCY	2 cut(s)	135, 562
EcoO65I	GGTNACC	1 cut(s)	640
EcoRI	GAATTC	3 cut(s)	151, 821, 910
EcoT14I	CCWWGG	1 cut(s)	604
EcoT22I	ATGCAT	1 cut(s)	776
ErhI	CCWWGG	1 cut(s)	604
FaeI	CATG	5 cut(s)	39, 179, 469, 544, 778
FaiI	YATR	9 cut(s)	37, 149, 177, 467, 542, 740, 772, 776, 872
FaqI	GGGAC	2 cut(s)	548, 990
FatI	CATG	5 cut(s)	35, 175, 465, 540, 774
FauI	CCCGC	1 cut(s)	32
Fnu4HI	GCNGC	4 cut(s)	324, 593, 667, 694
FokI	GGATG	2 cut(s)	469, 932
Fsp4HI	GCNGC	4 cut(s)	324, 593, 667, 694
FspBI	CTAG	4 cut(s)	581, 678, 684, 726
FspI	TGCGCA	1 cut(s)	570
GlaI	GCGC	1 cut(s)	570
GluI	GCNGC	4 cut(s)	324, 593, 667, 694
GsaI	CCCAGC	1 cut(s)	631
HaeIII	GGCC	1 cut(s)	1004
HapII	CCGG	5 cut(s)	45, 51, 64, 87, 104
HgaI	GACGC	1 cut(s)	267
HhaI	GCGC	1 cut(s)	571
Hin1I	GRCGYC	1 cut(s)	93
Hin1II	CATG	5 cut(s)	39, 179, 469, 544, 778
Hin6I	GCGC	1 cut(s)	569
HinP1I	GCGC	1 cut(s)	569
HincII	GTYRAC	1 cut(s)	538
HindII	GTYRAC	1 cut(s)	538
HinfI	GANTC	7 cut(s)	54, 127, 305, 479, 506, 935, 946
HpaII	CCGG	5 cut(s)	45, 51, 64, 87, 104
HphI	GGTGA	1 cut(s)	569
Hpy166II	GTNNAC	2 cut(s)	97, 538
Hpy188I	TCNGA	5 cut(s)	132, 288, 310, 352, 505
Hpy188III	TCNNGA	7 cut(s)	12, 235, 653, 798, 826, 917, 1024
Hpy8I	GTNNAC	2 cut(s)	97, 538
Hpy99I	CGWCG	2 cut(s)	95, 499
HpyCH4III	ACNGT	1 cut(s)	476
HpyCH4IV	ACGT	1 cut(s)	93
HpyCH4V	TGCA	8 cut(s)	359, 592, 669, 774, 789, 864, 882, 1049
HpyF10VI	GCNNNNNNNGC	1 cut(s)	786
HpyF3I	CTNAG	8 cut(s)	131, 285, 389, 396, 504, 551, 733, 1053
HpySE526I	ACGT	1 cut(s)	93
Hsp92I	GRCGYC	1 cut(s)	93
Hsp92II	CATG	5 cut(s)	39, 179, 469, 544, 778
HspAI	GCGC	1 cut(s)	569
Kzo9I	GATC	1 cut(s)	231
LmnI	GCTCC	1 cut(s)	268
Lsp1109I	GCAGC	4 cut(s)	310, 604, 653, 705
LweI	GCATC	2 cut(s)	194, 755
MaeI	CTAG	4 cut(s)	581, 678, 684, 726
MaeII	ACGT	1 cut(s)	93
MaeIII	GTNAC	2 cut(s)	640, 754
MalI	GATC	1 cut(s)	233
MbiI	CCGCTC	1 cut(s)	454
MboI	GATC	1 cut(s)	231
MfeI	CAATTG	1 cut(s)	377
MlsI	TGGCCA	1 cut(s)	1004
MluCI	AATT	7 cut(s)	73, 116, 151, 242, 377, 821, 910
MluNI	TGGCCA	1 cut(s)	1004
MlyI	GAGTC	3 cut(s)	136, 515, 929
MmeI	TCCRAC	2 cut(s)	282, 795
Mox20I	TGGCCA	1 cut(s)	1004
Mph1103I	ATGCAT	1 cut(s)	776
MscI	TGGCCA	1 cut(s)	1004
MseI	TTAA	3 cut(s)	255, 444, 1010
MslI	CAYNNNNRTG	1 cut(s)	971
Msp20I	TGGCCA	1 cut(s)	1004
MspCI	CTTAAG	1 cut(s)	443
MspI	CCGG	5 cut(s)	45, 51, 64, 87, 104
MspR9I	CCNGG	2 cut(s)	64, 105
MunI	CAATTG	1 cut(s)	377
MwoI	GCNNNNNNNGC	1 cut(s)	786
NciI	CCSGG	2 cut(s)	64, 105
NdeII	GATC	1 cut(s)	231
NlaIII	CATG	5 cut(s)	39, 179, 469, 544, 778
NlaIV	GGNNCC	4 cut(s)	49, 137, 198, 564
NmeAIII	GCCGAG	1 cut(s)	657
NmuCI	GTSAC	1 cut(s)	754
NsbI	TGCGCA	1 cut(s)	570
NsiI	ATGCAT	1 cut(s)	776
NspI	RCATGY	1 cut(s)	179
PfeI	GAWTC	4 cut(s)	54, 305, 479, 946
PkrI	GCNGC	4 cut(s)	325, 594, 668, 695
PleI	GAGTC	3 cut(s)	135, 514, 929
PpsI	GAGTC	3 cut(s)	135, 514, 929
PpuMI	RGGWCCY	2 cut(s)	135, 562
Psp5II	RGGWCCY	2 cut(s)	135, 562
PspEI	GGTNACC	1 cut(s)	640
PspFI	CCCAGC	1 cut(s)	627
PspN4I	GGNNCC	4 cut(s)	49, 137, 198, 564
PspPI	GGNCC	4 cut(s)	135, 562, 710, 890
PspPPI	RGGWCCY	2 cut(s)	135, 562
RsaI	GTAC	3 cut(s)	295, 682, 965
RsaNI	GTAC	3 cut(s)	294, 681, 964
RseI	CAYNNNNRTG	1 cut(s)	971
SaqAI	TTAA	3 cut(s)	255, 444, 1010
SatI	GCNGC	4 cut(s)	324, 593, 667, 694
Sau3AI	GATC	1 cut(s)	231
Sau96I	GGNCC	4 cut(s)	135, 562, 710, 890
ScaI	AGTACT	2 cut(s)	295, 682
SchI	GAGTC	3 cut(s)	136, 515, 929
ScrFI	CCNGG	2 cut(s)	64, 105
SfaNI	GCATC	2 cut(s)	194, 755
SfcI	CTRYAG	1 cut(s)	371
SinI	GGWCC	4 cut(s)	135, 562, 710, 890
SmiMI	CAYNNNNRTG	1 cut(s)	971
SmlI	CTYRAG	2 cut(s)	327, 443
SmoI	CTYRAG	2 cut(s)	327, 443
SpeI	ACTAGT	3 cut(s)	677, 683, 725
Sse9I	AATT	7 cut(s)	73, 116, 151, 242, 377, 821, 910
SsiI	CCGC	4 cut(s)	25, 207, 266, 454
SspMI	CTAG	4 cut(s)	581, 678, 684, 726
StyD4I	CCNGG	2 cut(s)	62, 103
StyI	CCWWGG	1 cut(s)	604
TaaI	ACNGT	1 cut(s)	476
TaiI	ACGT	1 cut(s)	96
TaqI	TCGA	5 cut(s)	57, 509, 599, 825, 843
TasI	AATT	7 cut(s)	73, 116, 151, 242, 377, 821, 910
TatI	WGTACW	3 cut(s)	293, 680, 963
TfiI	GAWTC	4 cut(s)	54, 305, 479, 946
Tru1I	TTAA	3 cut(s)	255, 444, 1010
Tru9I	TTAA	3 cut(s)	255, 444, 1010
TscAI	CASTG	3 cut(s)	676, 703, 1051
TseFI	GTSAC	1 cut(s)	754
TseI	GCWGC	4 cut(s)	323, 592, 666, 693
Tsp45I	GTSAC	1 cut(s)	754
TspDTI	ATGAA	8 cut(s)	66, 129, 164, 473, 480, 482, 557, 936
TspRI	CASTG	3 cut(s)	676, 703, 1051
Vha464I	CTTAAG	1 cut(s)	443
VpaK11BI	GGWCC	4 cut(s)	135, 562, 710, 890
XapI	RAATTY	5 cut(s)	73, 116, 151, 821, 910
XceI	RCATGY	1 cut(s)	179
XspI	CTAG	4 cut(s)	581, 678, 684, 726
ZraI	GACGTC	1 cut(s)	94
ZrmI	AGTACT	2 cut(s)	295, 682
Zsp2I	ATGCAT	1 cut(s)	776

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.