Rmu_sc0000255.1_g000018

NADH-ubiquinone oxidoreductase complex I, 21 kDa subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000255.1
Physical Location & Seq
Forward (+)
83687 .. 84089
403 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000255.1_g000018.1.cds

Sequence Viewer

Length: 303 bp
atgaacacagacatcacagcgtcgacgaagcccgagtacccggtcttagatcggaaccctcccttcaccagagtcgtcggcaatttcagcaccctcgactatttccgattcgccaccatcaccggcgtctccgtcaccgtcggctacctctccggaattaagccgggaattagagggccgtctatggtgaccggaggtctcattggagtgatgggcgggttcatgtacgcttaccagaactcggcgggtcgcatcatgggctttttccccaacgaccgtgaggtagcccattacaagaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

10.92

Weight (kDa)

9.63

Isoelectric Point (pI)

18.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 23
AccIII TCCGGA 1 cut(s) 152
AciI CCGC 2 cut(s) 216, 245
AcyI GRCGYC 1 cut(s) 126
AfaI GTAC 2 cut(s) 38, 227
AfiI CCNNNNNNNGG 1 cut(s) 241
AhdI GACNNNNNGTC 1 cut(s) 195
Alw26I GTCTC 2 cut(s) 133, 203
Ama87I CYCGRG 1 cut(s) 32
Aor13HI TCCGGA 1 cut(s) 152
AoxI GGCC 1 cut(s) 176
AspS9I GGNCC 1 cut(s) 176
AsuC2I CCSGG 2 cut(s) 41, 165
AsuHPI GGTGA 4 cut(s) 58, 112, 127, 199
AvaI CYCGRG 1 cut(s) 32
BarI GAAGNNNNNNTAC 2 cut(s) 20, 52
BccI CCATC 2 cut(s) 125, 205
BceAI ACGGC 1 cut(s) 163
BcnI CCSGG 2 cut(s) 41, 165
BcoDI GTCTC 2 cut(s) 133, 203
Bme1390I CCNGG 2 cut(s) 41, 165
BmeRI GACNNNNNGTC 1 cut(s) 195
BmeT110I CYCGRG 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 1 cut(s) 56
BmrFI CCNGG 2 cut(s) 41, 165
BmsI GCATC 1 cut(s) 261
BpuMI CCSGG 2 cut(s) 41, 165
BsaHI GRCGYC 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 203
BsaWI WCCGGW 2 cut(s) 152, 191
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse118I RCCGGY 1 cut(s) 122
BseAI TCCGGA 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 241
Bsh1285I CGRYCG 1 cut(s) 277
BshFI GGCC 1 cut(s) 178
BsiEI CGRYCG 1 cut(s) 277
BsiHKCI CYCGRG 1 cut(s) 32
BsiSI CCGG 5 cut(s) 41, 123, 153, 164, 192
BslI CCNNNNNNNGG 1 cut(s) 241
BsmAI GTCTC 2 cut(s) 133, 203
BsmBI CGTCTC 1 cut(s) 133
BsnI GGCC 1 cut(s) 178
Bso31I GGTCTC 1 cut(s) 203
BsoBI CYCGRG 1 cut(s) 32
Bsp13I TCCGGA 1 cut(s) 152
Bsp143I GATC 1 cut(s) 49
BspACI CCGC 2 cut(s) 216, 245
BspANI GGCC 1 cut(s) 178
BspEI TCCGGA 1 cut(s) 152
BspLI GGNNCC 1 cut(s) 56
BspTNI GGTCTC 1 cut(s) 203
BsrFI RCCGGY 1 cut(s) 122
BssAI RCCGGY 1 cut(s) 122
BssMI GATC 1 cut(s) 49
BssNI GRCGYC 1 cut(s) 126
Bst4CI ACNGT 2 cut(s) 139, 278
BstACI GRCGYC 1 cut(s) 126
BstDEI CTNAG 1 cut(s) 46
BstEII GGTNACC 1 cut(s) 187
BstKTI GATC 1 cut(s) 52
BstMAI GTCTC 2 cut(s) 133, 203
BstMBI GATC 1 cut(s) 49
BstMCI CGRYCG 1 cut(s) 277
BstMWI GCNNNNNNNGC 2 cut(s) 87, 258
BstPI GGTNACC 1 cut(s) 187
BstSCI CCNGG 2 cut(s) 39, 163
BsuRI GGCC 1 cut(s) 178
Cfr10I RCCGGY 1 cut(s) 122
Cfr13I GGNCC 1 cut(s) 176
CseI GACGC 2 cut(s) 9, 115
Csp6I GTAC 2 cut(s) 37, 226
CviAII CATG 2 cut(s) 223, 256
CviJI RGCY 6 cut(s) 31, 144, 163, 178, 261, 287
CviKI_1 RGCY 6 cut(s) 31, 144, 163, 178, 261, 287
CviQI GTAC 2 cut(s) 37, 226
DdeI CTNAG 1 cut(s) 46
DpnI GATC 1 cut(s) 51
DpnII GATC 1 cut(s) 49
DriI GACNNNNNGTC 1 cut(s) 195
Eam1105I GACNNNNNGTC 1 cut(s) 195
Eco31I GGTCTC 1 cut(s) 203
Eco88I CYCGRG 1 cut(s) 32
Eco91I GGTNACC 1 cut(s) 187
EcoO65I GGTNACC 1 cut(s) 187
Esp3I CGTCTC 1 cut(s) 133
FaeI CATG 2 cut(s) 226, 259
FaiI YATR 3 cut(s) 185, 224, 257
FatI CATG 2 cut(s) 222, 255
FauI CCCGC 2 cut(s) 209, 238
FblI GTMKAC 1 cut(s) 23
HaeIII GGCC 1 cut(s) 178
HapII CCGG 5 cut(s) 41, 123, 153, 164, 192
HgaI GACGC 2 cut(s) 9, 115
Hin1I GRCGYC 1 cut(s) 126
Hin1II CATG 2 cut(s) 226, 259
HincII GTYRAC 1 cut(s) 24
HindII GTYRAC 1 cut(s) 24
HinfI GANTC 2 cut(s) 72, 108
HpaII CCGG 5 cut(s) 41, 123, 153, 164, 192
HphI GGTGA 4 cut(s) 58, 112, 127, 199
Hpy166II GTNNAC 1 cut(s) 24
Hpy188I TCNGA 2 cut(s) 54, 107
Hpy188III TCNNGA 1 cut(s) 153
Hpy8I GTNNAC 1 cut(s) 24
Hpy99I CGWCG 4 cut(s) 25, 28, 80, 143
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 2 cut(s) 139, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 87, 258
HpyF3I CTNAG 1 cut(s) 46
Hsp92I GRCGYC 1 cut(s) 126
Hsp92II CATG 2 cut(s) 226, 259
Kpn2I TCCGGA 1 cut(s) 152
Kzo9I GATC 1 cut(s) 49
LpnPI CCDG 7 cut(s) 54, 82, 136, 166, 177, 205, 248
LweI GCATC 1 cut(s) 261
MaeIII GTNAC 2 cut(s) 133, 187
MalI GATC 1 cut(s) 51
MboI GATC 1 cut(s) 49
MluCI AATT 3 cut(s) 82, 156, 168
MlyI GAGTC 1 cut(s) 81
MnlI CCTC 6 cut(s) 69, 104, 158, 167, 188, 274
MroI TCCGGA 1 cut(s) 152
MseI TTAA 1 cut(s) 159
MslI CAYNNNNRTG 1 cut(s) 206
MspI CCGG 5 cut(s) 41, 123, 153, 164, 192
MspR9I CCNGG 2 cut(s) 41, 165
MwoI GCNNNNNNNGC 2 cut(s) 87, 258
NciI CCSGG 2 cut(s) 41, 165
NdeII GATC 1 cut(s) 49
NlaIII CATG 2 cut(s) 226, 259
NlaIV GGNNCC 1 cut(s) 56
NmeAIII GCCGAG 1 cut(s) 221
NmuCI GTSAC 2 cut(s) 133, 187
PfeI GAWTC 1 cut(s) 108
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
PspEI GGTNACC 1 cut(s) 187
PspN4I GGNNCC 1 cut(s) 56
PspPI GGNCC 1 cut(s) 176
RsaI GTAC 2 cut(s) 38, 227
RsaNI GTAC 2 cut(s) 37, 226
RseI CAYNNNNRTG 1 cut(s) 206
SalI GTCGAC 1 cut(s) 22
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 49
Sau96I GGNCC 1 cut(s) 176
SchI GAGTC 1 cut(s) 81
ScrFI CCNGG 2 cut(s) 41, 165
SetI ASST 3 cut(s) 150, 199, 285
SfaNI GCATC 1 cut(s) 261
SgrAI CRCCGGYG 1 cut(s) 122
SgrDI CGTCGACG 1 cut(s) 22
SmiMI CAYNNNNRTG 1 cut(s) 206
Sse9I AATT 3 cut(s) 82, 156, 168
SsiI CCGC 2 cut(s) 216, 245
StyD4I CCNGG 2 cut(s) 39, 163
TaaI ACNGT 2 cut(s) 139, 278
TaqI TCGA 2 cut(s) 23, 96
TasI AATT 3 cut(s) 82, 156, 168
TfiI GAWTC 1 cut(s) 108
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TseFI GTSAC 2 cut(s) 133, 187
Tsp45I GTSAC 2 cut(s) 133, 187
TspDTI ATGAA 2 cut(s) 17, 211
TspGWI ACGGA 1 cut(s) 121
XmiI GTMKAC 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.