Rmu_sc0000295.1_g000040

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000295.1
Physical Location & Seq
Reverse (-)
219787 .. 220494
708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000295.1_g000040.1.cds

Sequence Viewer

Length: 708 bp
atggcttcatggcaagtctttgaccttgtttctcactttcttgaccccaaaaccctagccatagcctgttgcgtctgcaagtcctggttcagttgcatttcctccgaccacatttggaagcccatttgcaccacccattacccttctctctctaatctcaagctcaccattccctactatcgcctctacgccatggcctctgccgcagccaaacgccgcttccagaccccctccaaaccctgccttgccctcgacaacctcatcttcaccgtcaacgtcttcaaccacaagaacgttctctgtctcgaaaaaccagggaacgagctagtcatggattccaatggggtgttcaagttcgatattgccgtcgataactacgagtttgaagctgtggcgttggagtcggtgagagttacgtggaatgtggtgttgaaagggtggaaaggggtttttaatatgttggaatgtcaagggaagaaaggggtcgactggtggttctgggaggagctgcctttgccggggtgttgctcgggcctcgtcgatagcggtgtcgtggcggatttgaggttggagtttactgatagcaaaaacaatgttgatgttgggcggatcaacaaagtgagcatggggatgttgagtacggtaaacttgagatatgtcagtgtggatgctgctctaagatacttgcaacactttcttagatattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

235

Amino Acids

26.7

Weight (kDa)

8.0

Isoelectric Point (pI)

31.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 486
AciI CCGC 5 cut(s) 204, 217, 546, 557, 607
AclI AACGTT 1 cut(s) 294
AclWI GGATC 1 cut(s) 617
AfaI GTAC 1 cut(s) 640
AfiI CCNNNNNNNGG 1 cut(s) 518
AgsI TTSAA 4 cut(s) 283, 352, 386, 433
AjnI CCWGG 2 cut(s) 83, 313
AjuI GAANNNNNNNTTGG 4 cut(s) 203, 235, 332, 364
AluBI AGCT 4 cut(s) 163, 325, 389, 508
AluI AGCT 4 cut(s) 163, 325, 389, 508
Alw26I GTCTC 1 cut(s) 308
AlwI GGATC 1 cut(s) 617
Ama87I CYCGRG 1 cut(s) 529
AoxI GGCC 2 cut(s) 195, 532
ApeKI GCWGC 3 cut(s) 206, 508, 671
AspS9I GGNCC 1 cut(s) 532
AsuC2I CCSGG 1 cut(s) 519
AsuHPI GGTGA 3 cut(s) 157, 259, 418
AvaI CYCGRG 1 cut(s) 529
BbsI GAAGAC 1 cut(s) 271
BbvI GCAGC 3 cut(s) 218, 495, 658
BceAI ACGGC 1 cut(s) 350
BciT130I CCWGG 2 cut(s) 85, 315
BcnI CCSGG 1 cut(s) 519
BcoDI GTCTC 1 cut(s) 308
BfaI CTAG 2 cut(s) 56, 326
BisI GCNGC 5 cut(s) 204, 207, 217, 509, 672
BlsI GCNGC 5 cut(s) 205, 208, 218, 510, 673
Bme1390I CCNGG 3 cut(s) 85, 315, 519
BmeT110I CYCGRG 1 cut(s) 529
BmgT120I GGNCC 1 cut(s) 532
BmrFI CCNGG 3 cut(s) 85, 315, 519
BmsI GCATC 1 cut(s) 658
BpiI GAAGAC 1 cut(s) 271
BpuEI CTTGAG 2 cut(s) 143, 670
BpuMI CCSGG 1 cut(s) 519
BsaAI YACGTR 1 cut(s) 417
BsaJI CCNNGG 3 cut(s) 192, 314, 518
Bsc4I CCNNNNNNNGG 1 cut(s) 518
Bse1I ACTGG 1 cut(s) 494
BseBI CCWGG 2 cut(s) 85, 315
BseDI CCNNGG 3 cut(s) 192, 314, 518
BseGI GGATG 2 cut(s) 636, 673
BseLI CCNNNNNNNGG 1 cut(s) 518
BseNI ACTGG 1 cut(s) 494
BseRI GAGGAG 1 cut(s) 518
BseXI GCAGC 3 cut(s) 218, 495, 658
BshFI GGCC 2 cut(s) 197, 534
BsiHKCI CYCGRG 1 cut(s) 529
BsiSI CCGG 1 cut(s) 518
BslI CCNNNNNNNGG 1 cut(s) 518
BsmAI GTCTC 1 cut(s) 308
BsnI GGCC 2 cut(s) 197, 534
BsoBI CYCGRG 1 cut(s) 529
Bsp143I GATC 1 cut(s) 609
Bsp19I CCATGG 1 cut(s) 192
BspACI CCGC 5 cut(s) 204, 217, 546, 557, 607
BspANI GGCC 2 cut(s) 197, 534
BspPI GGATC 1 cut(s) 617
BsrI ACTGG 1 cut(s) 494
BssECI CCNNGG 3 cut(s) 192, 314, 518
BssMI GATC 1 cut(s) 609
BssT1I CCWWGG 1 cut(s) 192
Bst2UI CCWGG 2 cut(s) 85, 315
Bst4CI ACNGT 2 cut(s) 271, 643
BstBAI YACGTR 1 cut(s) 417
BstDEI CTNAG 2 cut(s) 677, 698
BstDSI CCRYGG 1 cut(s) 192
BstF5I GGATG 2 cut(s) 636, 673
BstKTI GATC 1 cut(s) 612
BstMAI GTCTC 1 cut(s) 308
BstMBI GATC 1 cut(s) 609
BstMWI GCNNNNNNNGC 2 cut(s) 203, 514
BstNI CCWGG 2 cut(s) 85, 315
BstSCI CCNGG 3 cut(s) 83, 313, 517
BstV1I GCAGC 3 cut(s) 218, 495, 658
BstV2I GAAGAC 1 cut(s) 271
BsuRI GGCC 2 cut(s) 197, 534
BtgI CCRYGG 1 cut(s) 192
BtsCI GGATG 2 cut(s) 636, 673
BtsIMutI CAGTG 1 cut(s) 667
Cfr13I GGNCC 1 cut(s) 532
CseI GACGC 1 cut(s) 61
Csp6I GTAC 1 cut(s) 639
CviAII CATG 4 cut(s) 9, 193, 331, 625
CviQI GTAC 1 cut(s) 639
DdeI CTNAG 2 cut(s) 677, 698
DpnI GATC 1 cut(s) 611
DpnII GATC 1 cut(s) 609
EciI GGCGGA 2 cut(s) 572, 622
Eco130I CCWWGG 1 cut(s) 192
Eco88I CYCGRG 1 cut(s) 529
EcoRII CCWGG 2 cut(s) 83, 313
EcoT14I CCWWGG 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 192
FaeI CATG 4 cut(s) 12, 196, 334, 628
FaiI YATR 7 cut(s) 10, 62, 194, 332, 458, 626, 657
FatI CATG 4 cut(s) 8, 192, 330, 624
FblI GTMKAC 1 cut(s) 486
Fnu4HI GCNGC 5 cut(s) 204, 207, 217, 509, 672
FokI GGATG 2 cut(s) 643, 680
Fsp4HI GCNGC 5 cut(s) 204, 207, 217, 509, 672
FspBI CTAG 2 cut(s) 56, 326
GluI GCNGC 5 cut(s) 204, 207, 217, 509, 672
HaeIII GGCC 2 cut(s) 197, 534
HapII CCGG 1 cut(s) 518
HgaI GACGC 1 cut(s) 61
Hin1II CATG 4 cut(s) 12, 196, 334, 628
HincII GTYRAC 2 cut(s) 274, 487
HindII GTYRAC 2 cut(s) 274, 487
HinfI GANTC 2 cut(s) 335, 401
HpaII CCGG 1 cut(s) 518
HphI GGTGA 3 cut(s) 157, 259, 418
Hpy166II GTNNAC 4 cut(s) 274, 487, 576, 646
Hpy188I TCNGA 1 cut(s) 106
Hpy188III TCNNGA 3 cut(s) 41, 223, 305
Hpy8I GTNNAC 4 cut(s) 274, 487, 576, 646
Hpy99I CGWCG 2 cut(s) 371, 542
HpyAV CCTTC 1 cut(s) 153
HpyCH4III ACNGT 2 cut(s) 271, 643
HpyCH4IV ACGT 3 cut(s) 276, 294, 416
HpyCH4V TGCA 4 cut(s) 78, 96, 129, 688
HpyF10VI GCNNNNNNNGC 2 cut(s) 203, 514
HpyF3I CTNAG 2 cut(s) 677, 698
HpySE526I ACGT 3 cut(s) 276, 294, 416
Hsp92II CATG 4 cut(s) 12, 196, 334, 628
Kzo9I GATC 1 cut(s) 609
LmnI GCTCC 1 cut(s) 505
Lsp1109I GCAGC 3 cut(s) 218, 495, 658
LweI GCATC 1 cut(s) 658
MaeI CTAG 2 cut(s) 56, 326
MaeII ACGT 3 cut(s) 276, 294, 416
MaeIII GTNAC 1 cut(s) 412
MalI GATC 1 cut(s) 611
MboI GATC 1 cut(s) 609
MboII GAAGA 3 cut(s) 256, 271, 487
MlyI GAGTC 1 cut(s) 410
MmeI TCCRAC 4 cut(s) 129, 378, 441, 549
MnlI CCTC 9 cut(s) 112, 194, 208, 241, 260, 269, 496, 545, 558
MseI TTAA 1 cut(s) 453
MslI CAYNNNNRTG 1 cut(s) 629
MspI CCGG 1 cut(s) 518
MspR9I CCNGG 3 cut(s) 85, 315, 519
MvaI CCWGG 2 cut(s) 85, 315
MwoI GCNNNNNNNGC 2 cut(s) 203, 514
NciI CCSGG 1 cut(s) 519
NcoI CCATGG 1 cut(s) 192
NdeII GATC 1 cut(s) 609
NlaIII CATG 4 cut(s) 12, 196, 334, 628
PcsI WCGNNNNNNNCGW 2 cut(s) 363, 375
PfeI GAWTC 1 cut(s) 335
PkrI GCNGC 5 cut(s) 205, 208, 218, 510, 673
PleI GAGTC 1 cut(s) 409
PpsI GAGTC 1 cut(s) 409
Ppu21I YACGTR 1 cut(s) 417
Psp1406I AACGTT 1 cut(s) 294
Psp6I CCWGG 2 cut(s) 83, 313
PspGI CCWGG 2 cut(s) 83, 313
PspPI GGNCC 1 cut(s) 532
RsaI GTAC 1 cut(s) 640
RsaNI GTAC 1 cut(s) 639
RseI CAYNNNNRTG 1 cut(s) 629
SalI GTCGAC 1 cut(s) 485
SaqAI TTAA 1 cut(s) 453
SatI GCNGC 5 cut(s) 204, 207, 217, 509, 672
Sau3AI GATC 1 cut(s) 609
Sau96I GGNCC 1 cut(s) 532
SchI GAGTC 1 cut(s) 410
ScrFI CCNGG 3 cut(s) 85, 315, 519
SfaNI GCATC 1 cut(s) 658
SmiMI CAYNNNNRTG 1 cut(s) 629
SmlI CTYRAG 2 cut(s) 158, 649
SmoI CTYRAG 2 cut(s) 158, 649
SsiI CCGC 5 cut(s) 204, 217, 546, 557, 607
SspMI CTAG 2 cut(s) 56, 326
StyD4I CCNGG 3 cut(s) 83, 313, 517
StyI CCWWGG 1 cut(s) 192
TaaI ACNGT 2 cut(s) 271, 643
TaiI ACGT 3 cut(s) 279, 297, 419
TaqI TCGA 6 cut(s) 252, 306, 357, 369, 486, 540
TauI GCSGC 2 cut(s) 206, 219
TfiI GAWTC 1 cut(s) 335
Tru1I TTAA 1 cut(s) 453
Tru9I TTAA 1 cut(s) 453
TscAI CASTG 1 cut(s) 667
TseI GCWGC 3 cut(s) 206, 508, 671
TspRI CASTG 1 cut(s) 667
XmiI GTMKAC 1 cut(s) 486
XspI CTAG 2 cut(s) 56, 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.