Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000526.1

Orthogroup ID

OG0015539

Physical Location & Seq

Genomic Coordinates Forward (+)

55139 .. 57656

Gene Structure 2518 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000526.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1857 bp

atgtcaattgcacaaagagggtgtgattctgaaagagagatttggaagatggagaacggttggtccttaagtgtttctgataatgaagttgctggatcagttcgaacgagattggagtttgaggaaggcagagtgcagggaatggaggagatgaatgttgatactgaggatcgaaacttgacggaggtccctccaatccttcctccagattctaatctcgagattgtatctgctgggggttgtttctcaacctctcattctgattcaaaatctgtgaatcaaaagtcaaaacagaagaaagggatttttgaatttggggaaggcaaatctgtaggggtggaaggggatgatgttagagtttacaaaaggggaggtggaagaggtcggcgaagtgatggcagagagggttttgggggaggaggggggagtactaaggacaaggagaaagggaaggaagttgtctctgaaggtgtggagaatgatgggaagctaaagagaacgaaagatacggcagcattgggaggtcgaggtagaggtggaaaggggcgctatggctttccagtcagcggtcaggggcgtgggcactcctccaaccgagttcccccacgaaaatccaatcttgctgatgtctcaggagttagctggaatgtgcggggattggggaacccgcatacattccgagccttgaagaagtttcttcaagcgaaagaccccgacttggtggtcttaatggaaaccaagaaaaagaaggaggaaatggctgatatttgctttaatttgggttttggtgggtgtagtgtagtggggaaggtgggtcatagtagcggtggtttagccttgtgctggaagagtcagttggtcgtcaggcctttgggcttttcccaagggcatattgatgttgagatacagctgaatggggaaactatcagggtcactggtttttatggaaatccagaaactcatctctggcaattttcttgggaactcttgcgacgaatagctgcttcggtaaggggatcgtggattatctttggggattttaatgaattgctcagtgtttctgagaagattggtgggaatgagaggaagttgagttttcgagcccgatggttacttggagacgtggaaaattgggctgagagtaattctttgggaggcattcaaagaaatctatttactgtttcaaaggctttgaggcgttggaatgatgataatattggccatattccgcggaagataaggcagttgcagggggaggtatccaaatggccttttgataatctagatgacagggtacagcagatgagaaaggaggtattgggtgagtcgaacaggtttatggagcttgaggagtcattgtggaaacagaggtctcaggtgtcgtggttgaatgagggagatagtaacacaaaattctttcacgggtatgcaaagactcggggaagaaaaaacagcatacagggtattactaattcagagggagaatggcaggattctgataagggtattcaggatgctttcttagattacttctcaaagttgtttacttctgaagggtgtaactatatggagctggttctcgatgcggtgccacagaaagttaccaaggatatgaaccagaaacttgaacaaccttttacaaggactgatattgatgatgcattgaagcagatgggtccagacaagtcaccggatgtagatggtttctcagctcgattctatcagacttattgggaggtggttggaaatgatatcagtaagttctgtttgcaggttttgaatgatggagctgagttagctgggctcaatcacacattgttgcctttgattccgaaacttgataatcctatagaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

618

Amino Acids

68.89

Weight (kDa)

7.13

Isoelectric Point (pI)

36.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015539)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g13113
prunus_persica	Prupe.1G178200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0324001
rosa_multiflora	Rmu_sc0000526.1_g000014 Rmu_sc0002381.1_g000026 Rmu_sc0004684.1_g000006 Rmu_sc0011141.1_g000002
rosa_samantha	Rh1BG050000 Rh1DG065500 Rh2AG420500 Rh7DG114200 Rh7DG114400 Rh7DG149400
rosa_wichuraiana	Rw1G005070 Rw6G001310 Rw7G009650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	722
Acc36I	ACCTGC	1 cut(s)	1762
AccB1I	GGYRCC	1 cut(s)	1588
AccII	CGCG	1 cut(s)	1231
AciI	CCGC	7 cut(s)	567, 652, 668, 825, 1229, 1231, 1586
AclWI	GGATC	3 cut(s)	103, 177, 1024
AcoI	YGGCCR	1 cut(s)	1219
AcsI	RAATTY	2 cut(s)	311, 1412
AcuI	CTGAAG	2 cut(s)	486, 1572
AfaI	GTAC	2 cut(s)	430, 1296
AfiI	CCNNNNNNNGG	3 cut(s)	566, 718, 843
AflII	CTTAAG	1 cut(s)	67
AjiI	CACGTC	1 cut(s)	1123
AjuI	GAANNNNNNNTTGG	2 cut(s)	839, 871
AloI	GAACNNNNNNTCC	2 cut(s)	47, 79
AluBI	AGCT	9 cut(s)	490, 642, 910, 1001, 1345, 1573, 1712, 1790, 1799
AluI	AGCT	9 cut(s)	490, 642, 910, 1001, 1345, 1573, 1712, 1790, 1799
Alw26I	GTCTC	4 cut(s)	466, 634, 1113, 1377
AlwI	GGATC	3 cut(s)	103, 177, 1024
Ama87I	CYCGRG	2 cut(s)	218, 1437
AoxI	GGCC	3 cut(s)	866, 1219, 1268
ApeKI	GCWGC	2 cut(s)	512, 1001
ApoI	RAATTY	2 cut(s)	311, 1412
AspLEI	GCGC	1 cut(s)	549
AspS9I	GGNCC	3 cut(s)	63, 187, 1676
AsuHPI	GGTGA	2 cut(s)	1334, 1680
AsuII	TTCGAA	1 cut(s)	103
AvaI	CYCGRG	2 cut(s)	218, 1437
AvaII	GGWCC	3 cut(s)	63, 187, 1676
BaeGI	GKGCMC	1 cut(s)	585
BalI	TGGCCA	1 cut(s)	1221
BanI	GGYRCC	1 cut(s)	1588
BanII	GRGCYC	2 cut(s)	1105, 1806
BbvI	GCAGC	2 cut(s)	524, 988
BccI	CCATC	7 cut(s)	43, 389, 476, 1101, 1666, 1694, 1778
BceAI	ACGGC	1 cut(s)	525
BciVI	GTATCC	1 cut(s)	1270
BcoDI	GTCTC	4 cut(s)	466, 634, 1113, 1377
BfaI	CTAG	1 cut(s)	1283
BfmI	CTRYAG	2 cut(s)	330, 1848
BfoI	RGCGCY	1 cut(s)	550
BfrI	CTTAAG	1 cut(s)	67
BfuAI	ACCTGC	1 cut(s)	1762
BfuI	GTATCC	1 cut(s)	1270
BisI	GCNGC	2 cut(s)	513, 1002
BlsI	GCNGC	2 cut(s)	514, 1003
BmcAI	AGTACT	1 cut(s)	430
Bme18I	GGWCC	3 cut(s)	63, 187, 1676
BmeT110I	CYCGRG	2 cut(s)	218, 1437
BmgBI	CACGTC	1 cut(s)	1123
BmgT120I	GGNCC	3 cut(s)	63, 187, 1676
BmiI	GGNNCC	4 cut(s)	189, 665, 1590, 1677
BmsI	GCATC	3 cut(s)	1504, 1573, 1648
BoxI	GACNNNNGTC	1 cut(s)	185
BpmI	CTGGAG	1 cut(s)	189
Bpu14I	TTCGAA	1 cut(s)	103
BpuEI	CTTGAG	1 cut(s)	1367
BsaBI	GATNNNNATC	1 cut(s)	213
BsaI	GGTCTC	1 cut(s)	1377
BsaJI	CCNNGG	3 cut(s)	883, 1229, 1605
BsaWI	WCCGGW	1 cut(s)	1690
BsaXI	ACNNNNNCTCC	2 cut(s)	1343, 1373
Bsc4I	CCNNNNNNNGG	3 cut(s)	566, 718, 843
Bse1I	ACTGG	2 cut(s)	560, 940
Bse8I	GATNNNNATC	1 cut(s)	213
BseDI	CCNNGG	3 cut(s)	883, 1229, 1605
BseGI	GGATG	3 cut(s)	352, 1519, 1699
BseJI	GATNNNNATC	1 cut(s)	213
BseLI	CCNNNNNNNGG	3 cut(s)	566, 718, 843
BseMII	CTCAG	8 cut(s)	156, 645, 1053, 1066, 1128, 1388, 1722, 1782
BseNI	ACTGG	2 cut(s)	560, 940
BseRI	GAGGAG	4 cut(s)	161, 432, 577, 1364
BseSI	GKGCMC	1 cut(s)	585
BseXI	GCAGC	2 cut(s)	524, 988
BseYI	CCCAGC	2 cut(s)	233, 1799
BsgI	GTGCAG	1 cut(s)	155
Bsh1236I	CGCG	1 cut(s)	1231
BshFI	GGCC	3 cut(s)	868, 1221, 1270
BshNI	GGYRCC	1 cut(s)	1588
BsiHKCI	CYCGRG	2 cut(s)	218, 1437
BsiSI	CCGG	1 cut(s)	1691
BslFI	GGGAC	1 cut(s)	173
BslI	CCNNNNNNNGG	3 cut(s)	566, 718, 843
BsmAI	GTCTC	4 cut(s)	466, 634, 1113, 1377
BsmBI	CGTCTC	1 cut(s)	1113
BsmFI	GGGAC	1 cut(s)	173
BsmI	GAATGC	1 cut(s)	1158
BsnI	GGCC	3 cut(s)	868, 1221, 1270
Bso31I	GGTCTC	1 cut(s)	1377
BsoBI	CYCGRG	2 cut(s)	218, 1437
Bsp119I	TTCGAA	1 cut(s)	103
Bsp1286I	GDGCHC	3 cut(s)	585, 1105, 1806
Bsp143I	GATC	3 cut(s)	95, 169, 1016
BspACI	CCGC	7 cut(s)	567, 652, 668, 825, 1229, 1231, 1586
BspANI	GGCC	3 cut(s)	868, 1221, 1270
BspCNI	CTCAG	8 cut(s)	157, 644, 1054, 1065, 1129, 1387, 1721, 1783
BspFNI	CGCG	1 cut(s)	1231
BspLI	GGNNCC	4 cut(s)	189, 665, 1590, 1677
BspMI	ACCTGC	1 cut(s)	1762
BspPI	GGATC	3 cut(s)	103, 177, 1024
BspT104I	TTCGAA	1 cut(s)	103
BspT107I	GGYRCC	1 cut(s)	1588
BspTI	CTTAAG	1 cut(s)	67
BspTNI	GGTCTC	1 cut(s)	1377
BsrI	ACTGG	2 cut(s)	560, 940
BssECI	CCNNGG	3 cut(s)	883, 1229, 1605
BssMI	GATC	3 cut(s)	95, 169, 1016
BssT1I	CCWWGG	2 cut(s)	883, 1605
Bst4CI	ACNGT	2 cut(s)	59, 1180
Bst6I	CTCTTC	2 cut(s)	373, 842
BstAFI	CTTAAG	1 cut(s)	67
BstBI	TTCGAA	1 cut(s)	103
BstDSI	CCRYGG	1 cut(s)	1229
BstF5I	GGATG	3 cut(s)	352, 1519, 1699
BstFNI	CGCG	1 cut(s)	1231
BstH2I	RGCGCY	1 cut(s)	550
BstHHI	GCGC	1 cut(s)	549
BstKTI	GATC	3 cut(s)	98, 172, 1019
BstMAI	GTCTC	4 cut(s)	466, 634, 1113, 1377
BstMBI	GATC	3 cut(s)	95, 169, 1016
BstMWI	GCNNNNNNNGC	1 cut(s)	1796
BstPAI	GACNNNNGTC	1 cut(s)	185
BstSFI	CTRYAG	2 cut(s)	330, 1848
BstSLI	GKGCMC	1 cut(s)	585
BstUI	CGCG	1 cut(s)	1231
BstV1I	GCAGC	2 cut(s)	524, 988
BsuI	GTATCC	1 cut(s)	1270
BsuRI	GGCC	3 cut(s)	868, 1221, 1270
BtgI	CCRYGG	1 cut(s)	1229
BtrI	CACGTC	1 cut(s)	1123
BtsCI	GGATG	3 cut(s)	352, 1519, 1699
BtsIMutI	CAGTG	2 cut(s)	933, 1060
BveI	ACCTGC	1 cut(s)	1762
CfoI	GCGC	1 cut(s)	549
Cfr13I	GGNCC	3 cut(s)	63, 187, 1676
Cfr42I	CCGCGG	1 cut(s)	1232
Csp6I	GTAC	2 cut(s)	429, 1295
CviQI	GTAC	2 cut(s)	429, 1295
DpnI	GATC	3 cut(s)	97, 171, 1018
DpnII	GATC	3 cut(s)	95, 169, 1016
DrdI	GACNNNNNNGTC	1 cut(s)	722
DseDI	GACNNNNNNGTC	1 cut(s)	722
EaeI	YGGCCR	1 cut(s)	1219
Eam1104I	CTCTTC	2 cut(s)	373, 842
EarI	CTCTTC	2 cut(s)	373, 842
Eco130I	CCWWGG	2 cut(s)	883, 1605
Eco147I	AGGCCT	1 cut(s)	868
Eco24I	GRGCYC	2 cut(s)	1105, 1806
Eco31I	GGTCTC	1 cut(s)	1377
Eco32I	GATATC	1 cut(s)	1753
Eco47I	GGWCC	3 cut(s)	63, 187, 1676
Eco57I	CTGAAG	2 cut(s)	486, 1572
Eco88I	CYCGRG	2 cut(s)	218, 1437
EcoO109I	RGGNCCY	1 cut(s)	187
EcoRV	GATATC	1 cut(s)	1753
EcoT14I	CCWWGG	2 cut(s)	883, 1605
EcoT22I	ATGCAT	1 cut(s)	1663
EcoT38I	GRGCYC	2 cut(s)	1105, 1806
ErhI	CCWWGG	2 cut(s)	883, 1605
Esp3I	CGTCTC	1 cut(s)	1113
FaqI	GGGAC	1 cut(s)	173
FauI	CCCGC	2 cut(s)	645, 675
Fnu4HI	GCNGC	2 cut(s)	513, 1002
FokI	GGATG	3 cut(s)	359, 1526, 1706
FriOI	GRGCYC	2 cut(s)	1105, 1806
Fsp4HI	GCNGC	2 cut(s)	513, 1002
FspBI	CTAG	1 cut(s)	1283
GlaI	GCGC	1 cut(s)	548
GluI	GCNGC	2 cut(s)	513, 1002
GsaI	CCCAGC	2 cut(s)	237, 1803
GsuI	CTGGAG	1 cut(s)	189
HaeII	RGCGCY	1 cut(s)	550
HaeIII	GGCC	3 cut(s)	868, 1221, 1270
HapII	CCGG	1 cut(s)	1691
HhaI	GCGC	1 cut(s)	549
Hin6I	GCGC	1 cut(s)	547
HinP1I	GCGC	1 cut(s)	547
HpaII	CCGG	1 cut(s)	1691
HphI	GGTGA	2 cut(s)	1334, 1680
Hpy166II	GTNNAC	2 cut(s)	361, 1545
Hpy188III	TCNNGA	9 cut(s)	206, 218, 220, 633, 953, 1283, 1511, 1580, 1679
Hpy8I	GTNNAC	2 cut(s)	361, 1545
Hpy99I	CGWCG	1 cut(s)	996
HpyAV	CCTTC	9 cut(s)	119, 209, 314, 335, 445, 461, 742, 802, 1547
HpyCH4III	ACNGT	2 cut(s)	59, 1180
HpyCH4IV	ACGT	1 cut(s)	1122
HpyCH4V	TGCA	6 cut(s)	11, 136, 1249, 1430, 1661, 1771
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1796
HpySE526I	ACGT	1 cut(s)	1122
HspAI	GCGC	1 cut(s)	547
KspI	CCGCGG	1 cut(s)	1232
Kzo9I	GATC	3 cut(s)	95, 169, 1016
LmnI	GCTCC	3 cut(s)	1342, 1570, 1787
Lsp1109I	GCAGC	2 cut(s)	524, 988
LweI	GCATC	3 cut(s)	1504, 1573, 1648
MaeI	CTAG	1 cut(s)	1283
MaeII	ACGT	1 cut(s)	1122
MaeIII	GTNAC	6 cut(s)	931, 1110, 1403, 1559, 1600, 1686
MalI	GATC	3 cut(s)	97, 171, 1018
MboI	GATC	3 cut(s)	95, 169, 1016
MboII	GAAGA	9 cut(s)	58, 307, 390, 689, 700, 859, 1078, 1246, 1455
MfeI	CAATTG	1 cut(s)	6
MhlI	GDGCHC	3 cut(s)	585, 1105, 1806
MlsI	TGGCCA	1 cut(s)	1221
MluCI	AATT	9 cut(s)	6, 311, 775, 971, 1046, 1129, 1144, 1412, 1471
MluNI	TGGCCA	1 cut(s)	1221
MlyI	GAGTC	4 cut(s)	859, 1334, 1361, 1429
MmeI	TCCRAC	3 cut(s)	615, 1181, 1723
Mox20I	TGGCCA	1 cut(s)	1221
Mph1103I	ATGCAT	1 cut(s)	1663
MscI	TGGCCA	1 cut(s)	1221
MseI	TTAA	4 cut(s)	68, 728, 774, 1041
MslI	CAYNNNNRTG	2 cut(s)	894, 1425
Msp20I	TGGCCA	1 cut(s)	1221
MspA1I	CMGCKG	3 cut(s)	567, 910, 1231
MspCI	CTTAAG	1 cut(s)	67
MspI	CCGG	1 cut(s)	1691
MunI	CAATTG	1 cut(s)	6
Mva1269I	GAATGC	1 cut(s)	1158
MvnI	CGCG	1 cut(s)	1231
MwoI	GCNNNNNNNGC	1 cut(s)	1796
NdeII	GATC	3 cut(s)	95, 169, 1016
NlaIV	GGNNCC	4 cut(s)	189, 665, 1590, 1677
NmuCI	GTSAC	2 cut(s)	931, 1686
NsiI	ATGCAT	1 cut(s)	1663
NspV	TTCGAA	1 cut(s)	103
PaeR7I	CTCGAG	1 cut(s)	218
PceI	AGGCCT	1 cut(s)	868
PctI	GAATGC	1 cut(s)	1158
PfeI	GAWTC	7 cut(s)	26, 209, 263, 277, 1493, 1716, 1828
PkrI	GCNGC	2 cut(s)	514, 1003
PleI	GAGTC	4 cut(s)	858, 1333, 1360, 1429
PpsI	GAGTC	4 cut(s)	858, 1333, 1360, 1429
PpuMI	RGGWCCY	1 cut(s)	187
PshAI	GACNNNNGTC	1 cut(s)	185
Psp5II	RGGWCCY	1 cut(s)	187
PspFI	CCCAGC	2 cut(s)	233, 1799
PspN4I	GGNNCC	4 cut(s)	189, 665, 1590, 1677
PspPI	GGNCC	3 cut(s)	63, 187, 1676
PspPPI	RGGWCCY	1 cut(s)	187
PsrI	GAACNNNNNNTAC	2 cut(s)	490, 522
PvuII	CAGCTG	1 cut(s)	910
RsaI	GTAC	2 cut(s)	430, 1296
RsaNI	GTAC	2 cut(s)	429, 1295
RseI	CAYNNNNRTG	2 cut(s)	894, 1425
SacII	CCGCGG	1 cut(s)	1232
SaqAI	TTAA	4 cut(s)	68, 728, 774, 1041
SatI	GCNGC	2 cut(s)	513, 1002
Sau3AI	GATC	3 cut(s)	95, 169, 1016
Sau96I	GGNCC	3 cut(s)	63, 187, 1676
ScaI	AGTACT	1 cut(s)	430
SchI	GAGTC	4 cut(s)	859, 1334, 1361, 1429
SduI	GDGCHC	3 cut(s)	585, 1105, 1806
SfaNI	GCATC	3 cut(s)	1504, 1573, 1648
SfcI	CTRYAG	2 cut(s)	330, 1848
Sfr274I	CTCGAG	1 cut(s)	218
Sfr303I	CCGCGG	1 cut(s)	1232
SfuI	TTCGAA	1 cut(s)	103
SgrBI	CCGCGG	1 cut(s)	1232
SinI	GGWCC	3 cut(s)	63, 187, 1676
SlaI	CTCGAG	1 cut(s)	218
SmiMI	CAYNNNNRTG	2 cut(s)	894, 1425
SmlI	CTYRAG	3 cut(s)	67, 218, 1346
SmoI	CTYRAG	3 cut(s)	67, 218, 1346
Sse9I	AATT	9 cut(s)	6, 311, 775, 971, 1046, 1129, 1144, 1412, 1471
SseBI	AGGCCT	1 cut(s)	868
SsiI	CCGC	7 cut(s)	567, 652, 668, 825, 1229, 1231, 1586
SspI	AATATT	1 cut(s)	1216
SspMI	CTAG	1 cut(s)	1283
StuI	AGGCCT	1 cut(s)	868
StyI	CCWWGG	2 cut(s)	883, 1605
TaaI	ACNGT	2 cut(s)	59, 1180
TaiI	ACGT	1 cut(s)	1125
TaqI	TCGA	8 cut(s)	103, 172, 219, 526, 1099, 1328, 1581, 1714
TasI	AATT	9 cut(s)	6, 311, 775, 971, 1046, 1129, 1144, 1412, 1471
TatI	WGTACW	1 cut(s)	428
TfiI	GAWTC	7 cut(s)	26, 209, 263, 277, 1493, 1716, 1828
Tru1I	TTAA	4 cut(s)	68, 728, 774, 1041
Tru9I	TTAA	4 cut(s)	68, 728, 774, 1041
TscAI	CASTG	2 cut(s)	940, 1060
TseFI	GTSAC	2 cut(s)	931, 1686
TseI	GCWGC	2 cut(s)	512, 1001
Tsp45I	GTSAC	2 cut(s)	931, 1686
TspDTI	ATGAA	4 cut(s)	99, 167, 1059, 1628
TspGWI	ACGGA	1 cut(s)	197
TspRI	CASTG	2 cut(s)	940, 1060
Vha464I	CTTAAG	1 cut(s)	67
VpaK11BI	GGWCC	3 cut(s)	63, 187, 1676
XapI	RAATTY	2 cut(s)	311, 1412
XbaI	TCTAGA	1 cut(s)	1282
XhoI	CTCGAG	1 cut(s)	218
XspI	CTAG	1 cut(s)	1283
ZrmI	AGTACT	1 cut(s)	430
Zsp2I	ATGCAT	1 cut(s)	1663

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.