Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002381.1

Orthogroup ID

OG0015539

Physical Location & Seq

Genomic Coordinates Reverse (-)

87740 .. 90043

Gene Structure 2304 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002381.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1032 bp

atggcaataattaagcctcgaaagccaattcttattcggaatacaggtttggagactcgaactgcagatgcttgtatagaaggtactagcaaggatgctctagcgctggttccttttgaggagatgctgacagatttgaagcgcagcaggccagcttcccctttctcttccccaaagaaactcaagtttttgctaggaggaattctgatttcgaaggaaagtttaatcccaaaagcggacacacaaccaaccaagaagaagaaaggaaggcctttgggatcaaagaacaagaatccctgcaagacaaagaaggtagaagtggtggagggtcggctctttgttggaaaaagtcatctggtagtaaggccatttggttcatccttgggtcatattgatgtggaggtgcagactcaggaccgaccattgcgggtgaaatcagaggagaattcatttaatttgagtccttttggagaatgtagggagcaagaagatgtaagcaacaaactgagaagggcagcagaagctctaaagcactggaatgccgacacaattgggtacattccaaggaaaatcaagcaattgaatacagctttgcagggtcttcttctggatagtactaatgaagtaacagctgcaaatatgaagacaactgttagtgagttacgtaaatatttggagtttgaggaagaagcctggaaacaaaagtcaagagtggcctggttacaagagggagaccaaaatactaaattctttcatgggtatgccaaaagtagagggagaagaaacaaggttacaggaattatagatttgaatgggaactggaaagataatgatgtggatatacgattggctttctcggcatattttcagcatttctttactacagaggggtacaggtacatggatttgggtctagactctagaagctattccgccgaagataaccaacgagatgaatgcgaagttggcaaggcctttcatgaggaggctttgaagcaaatggcaccagacaagtcaccagtcaccacgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

343

Amino Acids

38.82

Weight (kDa)

9.38

Isoelectric Point (pI)

48.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015539)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g13113
prunus_persica	Prupe.1G178200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0324001
rosa_multiflora	Rmu_sc0000526.1_g000014 Rmu_sc0002381.1_g000026 Rmu_sc0004684.1_g000006 Rmu_sc0011141.1_g000002
rosa_samantha	Rh1BG050000 Rh1DG065500 Rh2AG420500 Rh7DG114200 Rh7DG114400 Rh7DG149400
rosa_wichuraiana	Rw1G005070 Rw6G001310 Rw7G009650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	1003
AciI	CCGC	3 cut(s)	236, 427, 933
AclWI	GGATC	1 cut(s)	286
AcsI	RAATTY	3 cut(s)	201, 445, 746
AcvI	CACGTG	1 cut(s)	1029
AdeI	CACNNNGTG	1 cut(s)	1029
AfaI	GTAC	5 cut(s)	85, 557, 616, 893, 899
AfeI	AGCGCT	1 cut(s)	105
AfiI	CCNNNNNNNGG	1 cut(s)	235
AgsI	TTSAA	4 cut(s)	139, 583, 811, 994
AjnI	CCWGG	2 cut(s)	692, 716
AjuI	GAANNNNNNNTTGG	4 cut(s)	32, 64, 948, 980
AluBI	AGCT	5 cut(s)	155, 524, 590, 632, 927
AluI	AGCT	5 cut(s)	155, 524, 590, 632, 927
Alw26I	GTCTC	2 cut(s)	47, 726
AlwI	GGATC	1 cut(s)	286
Aor51HI	AGCGCT	1 cut(s)	105
AoxI	GGCC	5 cut(s)	149, 269, 365, 714, 972
ApeKI	GCWGC	3 cut(s)	144, 515, 632
ApoI	RAATTY	3 cut(s)	201, 445, 746
Asp700I	GAANNNNTTC	1 cut(s)	928
AspLEI	GCGC	2 cut(s)	106, 144
AspS9I	GGNCC	1 cut(s)	415
AsuHPI	GGTGA	3 cut(s)	442, 1008, 1015
AsuII	TTCGAA	1 cut(s)	212
AvaII	GGWCC	1 cut(s)	415
BanI	GGYRCC	1 cut(s)	1003
BbrPI	CACGTG	1 cut(s)	1029
BbsI	GAAGAC	2 cut(s)	593, 650
BbvI	GCAGC	3 cut(s)	156, 527, 619
BcgI	CGANNNNNNTGC	2 cut(s)	939, 973
BciT130I	CCWGG	2 cut(s)	694, 718
BcoDI	GTCTC	2 cut(s)	47, 726
BfaI	CTAG	5 cut(s)	87, 101, 194, 914, 921
BfmI	CTRYAG	2 cut(s)	63, 882
BfoI	RGCGCY	1 cut(s)	107
BisI	GCNGC	3 cut(s)	145, 516, 633
BlsI	GCNGC	3 cut(s)	146, 517, 634
BmcAI	AGTACT	1 cut(s)	616
Bme1390I	CCNGG	2 cut(s)	694, 718
Bme18I	GGWCC	1 cut(s)	415
BmgT120I	GGNCC	1 cut(s)	415
BmiI	GGNNCC	2 cut(s)	111, 1005
BmrFI	CCNGG	2 cut(s)	694, 718
BmsI	GCATC	3 cut(s)	58, 85, 114
BpiI	GAAGAC	2 cut(s)	593, 650
Bpu14I	TTCGAA	1 cut(s)	212
BpuEI	CTTGAG	1 cut(s)	167
BsaAI	YACGTR	2 cut(s)	665, 1029
BsaI	GGTCTC	1 cut(s)	726
BsaJI	CCNNGG	2 cut(s)	381, 563
Bsc4I	CCNNNNNNNGG	1 cut(s)	235
Bse1I	ACTGG	3 cut(s)	539, 824, 1019
Bse3DI	GCAATG	1 cut(s)	422
BseBI	CCWGG	2 cut(s)	694, 718
BseDI	CCNNGG	2 cut(s)	381, 563
BseGI	GGATG	2 cut(s)	100, 377
BseLI	CCNNNNNNNGG	1 cut(s)	235
BseMI	GCAATG	1 cut(s)	422
BseMII	CTCAG	2 cut(s)	425, 497
BseNI	ACTGG	3 cut(s)	539, 824, 1019
BseRI	GAGGAG	3 cut(s)	134, 455, 998
BseXI	GCAGC	3 cut(s)	156, 527, 619
BsgI	GTGCAG	1 cut(s)	425
BshFI	GGCC	5 cut(s)	151, 271, 367, 716, 974
BshNI	GGYRCC	1 cut(s)	1003
BslI	CCNNNNNNNGG	1 cut(s)	235
BsmAI	GTCTC	2 cut(s)	47, 726
BsmI	GAATGC	2 cut(s)	544, 962
BsnI	GGCC	5 cut(s)	151, 271, 367, 716, 974
Bso31I	GGTCTC	1 cut(s)	726
Bsp119I	TTCGAA	1 cut(s)	212
Bsp143I	GATC	1 cut(s)	278
BspACI	CCGC	3 cut(s)	236, 427, 933
BspANI	GGCC	5 cut(s)	151, 271, 367, 716, 974
BspCNI	CTCAG	2 cut(s)	424, 498
BspHI	TCATGA	1 cut(s)	979
BspLI	GGNNCC	2 cut(s)	111, 1005
BspMAI	CTGCAG	1 cut(s)	67
BspPI	GGATC	1 cut(s)	286
BspT104I	TTCGAA	1 cut(s)	212
BspT107I	GGYRCC	1 cut(s)	1003
BspTNI	GGTCTC	1 cut(s)	726
BsrDI	GCAATG	1 cut(s)	422
BsrI	ACTGG	3 cut(s)	539, 824, 1019
BssECI	CCNNGG	2 cut(s)	381, 563
BssMI	GATC	1 cut(s)	278
BssT1I	CCWWGG	2 cut(s)	381, 563
Bst2UI	CCWGG	2 cut(s)	694, 718
Bst4CI	ACNGT	1 cut(s)	652
Bst6I	CTCTTC	1 cut(s)	172
BstBAI	YACGTR	2 cut(s)	665, 1029
BstBI	TTCGAA	1 cut(s)	212
BstC8I	GCNNGC	2 cut(s)	149, 153
BstDEI	CTNAG	2 cut(s)	411, 506
BstF5I	GGATG	2 cut(s)	100, 377
BstH2I	RGCGCY	1 cut(s)	107
BstHHI	GCGC	2 cut(s)	106, 144
BstKTI	GATC	1 cut(s)	281
BstMAI	GTCTC	2 cut(s)	47, 726
BstMBI	GATC	1 cut(s)	278
BstMWI	GCNNNNNNNGC	5 cut(s)	22, 148, 521, 857, 966
BstNI	CCWGG	2 cut(s)	694, 718
BstSCI	CCNGG	2 cut(s)	692, 716
BstSFI	CTRYAG	2 cut(s)	63, 882
BstSNI	TACGTA	1 cut(s)	665
BstV1I	GCAGC	3 cut(s)	156, 527, 619
BstV2I	GAAGAC	2 cut(s)	593, 650
BsuRI	GGCC	5 cut(s)	151, 271, 367, 716, 974
BtsCI	GGATG	2 cut(s)	100, 377
BtsIMutI	CAGTG	1 cut(s)	532
Cac8I	GCNNGC	2 cut(s)	149, 153
CciI	TCATGA	1 cut(s)	979
CfoI	GCGC	2 cut(s)	106, 144
Cfr13I	GGNCC	1 cut(s)	415
Csp6I	GTAC	5 cut(s)	84, 556, 615, 892, 898
CviAII	CATG	3 cut(s)	755, 901, 980
CviQI	GTAC	5 cut(s)	84, 556, 615, 892, 898
DdeI	CTNAG	2 cut(s)	411, 506
DpnI	GATC	1 cut(s)	280
DpnII	GATC	1 cut(s)	278
DraIII	CACNNNGTG	1 cut(s)	1029
Eam1104I	CTCTTC	1 cut(s)	172
EarI	CTCTTC	1 cut(s)	172
EciI	GGCGGA	1 cut(s)	922
Eco105I	TACGTA	1 cut(s)	665
Eco130I	CCWWGG	2 cut(s)	381, 563
Eco147I	AGGCCT	2 cut(s)	271, 974
Eco31I	GGTCTC	1 cut(s)	726
Eco47I	GGWCC	1 cut(s)	415
Eco47III	AGCGCT	1 cut(s)	105
Eco72I	CACGTG	1 cut(s)	1029
EcoRI	GAATTC	2 cut(s)	201, 445
EcoRII	CCWGG	2 cut(s)	692, 716
EcoT14I	CCWWGG	2 cut(s)	381, 563
ErhI	CCWWGG	2 cut(s)	381, 563
FaeI	CATG	3 cut(s)	758, 904, 983
FatI	CATG	3 cut(s)	754, 900, 979
FauI	CCCGC	1 cut(s)	420
Fnu4HI	GCNGC	3 cut(s)	145, 516, 633
FokI	GGATG	2 cut(s)	107, 364
Fsp4HI	GCNGC	3 cut(s)	145, 516, 633
FspBI	CTAG	5 cut(s)	87, 101, 194, 914, 921
GlaI	GCGC	2 cut(s)	105, 143
GluI	GCNGC	3 cut(s)	145, 516, 633
HaeII	RGCGCY	1 cut(s)	107
HaeIII	GGCC	5 cut(s)	151, 271, 367, 716, 974
HhaI	GCGC	2 cut(s)	106, 144
Hin1II	CATG	3 cut(s)	758, 904, 983
Hin6I	GCGC	2 cut(s)	104, 142
HinP1I	GCGC	2 cut(s)	104, 142
HinfI	GANTC	5 cut(s)	55, 292, 409, 460, 917
HphI	GGTGA	3 cut(s)	442, 1008, 1015
Hpy188I	TCNGA	3 cut(s)	39, 207, 439
Hpy188III	TCNNGA	6 cut(s)	413, 608, 708, 914, 921, 980
HpyAV	CCTTC	5 cut(s)	74, 208, 261, 304, 504
HpyCH4III	ACNGT	1 cut(s)	652
HpyCH4IV	ACGT	2 cut(s)	664, 1028
HpyCH4V	TGCA	5 cut(s)	65, 300, 406, 595, 635
HpyF10VI	GCNNNNNNNGC	5 cut(s)	22, 148, 521, 857, 966
HpyF3I	CTNAG	2 cut(s)	411, 506
HpySE526I	ACGT	2 cut(s)	664, 1028
Hsp92II	CATG	3 cut(s)	758, 904, 983
HspAI	GCGC	2 cut(s)	104, 142
Kzo9I	GATC	1 cut(s)	278
LmnI	GCTCC	1 cut(s)	481
Lsp1109I	GCAGC	3 cut(s)	156, 527, 619
LweI	GCATC	3 cut(s)	58, 85, 114
MaeI	CTAG	5 cut(s)	87, 101, 194, 914, 921
MaeII	ACGT	2 cut(s)	664, 1028
MaeIII	GTNAC	6 cut(s)	625, 660, 720, 790, 1014, 1021
MalI	GATC	1 cut(s)	280
MboI	GATC	1 cut(s)	278
MfeI	CAATTG	2 cut(s)	549, 578
MluCI	AATT	9 cut(s)	9, 27, 201, 445, 454, 549, 578, 746, 798
MlyI	GAGTC	4 cut(s)	49, 403, 469, 911
MmeI	TCCRAC	1 cut(s)	322
MroXI	GAANNNNTTC	1 cut(s)	928
MseI	TTAA	3 cut(s)	12, 224, 453
MslI	CAYNNNNRTG	3 cut(s)	393, 537, 759
MspA1I	CMGCKG	1 cut(s)	632
MspR9I	CCNGG	2 cut(s)	694, 718
MunI	CAATTG	2 cut(s)	549, 578
Mva1269I	GAATGC	2 cut(s)	544, 962
MvaI	CCWGG	2 cut(s)	694, 718
MwoI	GCNNNNNNNGC	5 cut(s)	22, 148, 521, 857, 966
NdeII	GATC	1 cut(s)	278
NlaIII	CATG	3 cut(s)	758, 904, 983
NlaIV	GGNNCC	2 cut(s)	111, 1005
NmeAIII	GCCGAG	1 cut(s)	836
NmuCI	GTSAC	2 cut(s)	1014, 1021
NspV	TTCGAA	1 cut(s)	212
PagI	TCATGA	1 cut(s)	979
PceI	AGGCCT	2 cut(s)	271, 974
PctI	GAATGC	2 cut(s)	544, 962
PdmI	GAANNNNTTC	1 cut(s)	928
PfeI	GAWTC	1 cut(s)	292
PkrI	GCNGC	3 cut(s)	146, 517, 634
PleI	GAGTC	4 cut(s)	49, 403, 468, 911
PmaCI	CACGTG	1 cut(s)	1029
PmlI	CACGTG	1 cut(s)	1029
PpsI	GAGTC	4 cut(s)	49, 403, 468, 911
Ppu21I	YACGTR	2 cut(s)	665, 1029
Psp6I	CCWGG	2 cut(s)	692, 716
PspCI	CACGTG	1 cut(s)	1029
PspGI	CCWGG	2 cut(s)	692, 716
PspN4I	GGNNCC	2 cut(s)	111, 1005
PspPI	GGNCC	1 cut(s)	415
PstI	CTGCAG	1 cut(s)	67
PvuII	CAGCTG	1 cut(s)	632
RsaI	GTAC	5 cut(s)	85, 557, 616, 893, 899
RsaNI	GTAC	5 cut(s)	84, 556, 615, 892, 898
RseI	CAYNNNNRTG	3 cut(s)	393, 537, 759
SaqAI	TTAA	3 cut(s)	12, 224, 453
SatI	GCNGC	3 cut(s)	145, 516, 633
Sau3AI	GATC	1 cut(s)	278
Sau96I	GGNCC	1 cut(s)	415
ScaI	AGTACT	1 cut(s)	616
SchI	GAGTC	4 cut(s)	49, 403, 469, 911
ScrFI	CCNGG	2 cut(s)	694, 718
SfaNI	GCATC	3 cut(s)	58, 85, 114
SfcI	CTRYAG	2 cut(s)	63, 882
SfuI	TTCGAA	1 cut(s)	212
SinI	GGWCC	1 cut(s)	415
SmiMI	CAYNNNNRTG	3 cut(s)	393, 537, 759
SmlI	CTYRAG	1 cut(s)	182
SmoI	CTYRAG	1 cut(s)	182
SnaBI	TACGTA	1 cut(s)	665
Sse9I	AATT	9 cut(s)	9, 27, 201, 445, 454, 549, 578, 746, 798
SseBI	AGGCCT	2 cut(s)	271, 974
SsiI	CCGC	3 cut(s)	236, 427, 933
SspI	AATATT	1 cut(s)	671
SspMI	CTAG	5 cut(s)	87, 101, 194, 914, 921
StuI	AGGCCT	2 cut(s)	271, 974
StyD4I	CCNGG	2 cut(s)	692, 716
StyI	CCWWGG	2 cut(s)	381, 563
TaaI	ACNGT	1 cut(s)	652
TaiI	ACGT	2 cut(s)	667, 1031
TaqI	TCGA	3 cut(s)	19, 58, 212
TaqII	GACCGA	1 cut(s)	432
TasI	AATT	9 cut(s)	9, 27, 201, 445, 454, 549, 578, 746, 798
TatI	WGTACW	1 cut(s)	614
TfiI	GAWTC	1 cut(s)	292
Tru1I	TTAA	3 cut(s)	12, 224, 453
Tru9I	TTAA	3 cut(s)	12, 224, 453
TscAI	CASTG	1 cut(s)	539
TseFI	GTSAC	2 cut(s)	1014, 1021
TseI	GCWGC	3 cut(s)	144, 515, 632
Tsp45I	GTSAC	2 cut(s)	1014, 1021
TspDTI	ATGAA	7 cut(s)	366, 438, 636, 656, 743, 968, 969
TspRI	CASTG	1 cut(s)	539
VpaK11BI	GGWCC	1 cut(s)	415
XapI	RAATTY	3 cut(s)	201, 445, 746
XbaI	TCTAGA	2 cut(s)	913, 920
XmnI	GAANNNNTTC	1 cut(s)	928
XspI	CTAG	5 cut(s)	87, 101, 194, 914, 921
ZrmI	AGTACT	1 cut(s)	616

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.