Rmu_sc0011141.1_g000002

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011141.1
OG0015539
Physical Location & Seq
Reverse (-)
8851 .. 9546
696 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011141.1_g000002.1.cds

Sequence Viewer

Length: 696 bp
atgggggtagctaaggcccttcagtgttggattgtgaataggttcagacacattccaaagaaaattcgtcacttaaataaagaacttgaggtatggccttttgatagtctggatgtggaagtacagagaaggagaagggagatagtcactgaattgaataccgctttggaaattgaggaatcaatttggaagcagcgttccagagtttcatggctgcaagaaggggatcgcaatactaaatttttccatggttatgcaaaggggagaggtagaagaaaccgcgttttgggaattaatagtagggagggtgtctggcaagagaatgaggaggagattcagaaggctttcagagatcatttctctagcttattcacttctgaggggtgtcgtcatatggagttggttttagatgctattcctcggaaagttacggaggaaatgaatggtaaattggagaagcctttcaccagattagatatcgaagaagctctgaagcagatggggccatataagtcaccaggggaagatggattttctgctagattctaccagacgtattgggaagtggtgggagaggaggtcagtaagttctgtttacaagttcagaatgatggcgctagtttgggggatttaaaccatactcttttggcgcttataccaaaggtggaaaacccacagaatgtcacaaactactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

231

Amino Acids

27.05

Weight (kDa)

7.03

Isoelectric Point (pI)

55.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 282
AciI CCGC 2 cut(s) 162, 280
AclWI GGATC 1 cut(s) 234
AcsI RAATTY 2 cut(s) 63, 239
AcuI CTGAAG 2 cut(s) 5, 512
AfaI GTAC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 286
AgsI TTSAA 1 cut(s) 157
AjnI CCWGG 1 cut(s) 517
AjuI GAANNNNNNNTTGG 4 cut(s) 149, 181, 434, 466
AloI GAACNNNNNNTCC 2 cut(s) 181, 213
AluBI AGCT 3 cut(s) 11, 366, 488
AluI AGCT 3 cut(s) 11, 366, 488
AlwI GGATC 1 cut(s) 234
AoxI GGCC 3 cut(s) 15, 95, 503
ApeKI GCWGC 2 cut(s) 193, 214
ApoI RAATTY 2 cut(s) 63, 239
AseI ATTAAT 1 cut(s) 294
Asp700I GAANNNNTTC 3 cut(s) 41, 344, 461
AspLEI GCGC 2 cut(s) 617, 652
AspS9I GGNCC 2 cut(s) 16, 503
AsuHPI GGTGA 2 cut(s) 457, 507
BbvI GCAGC 2 cut(s) 201, 205
BccI CCATC 3 cut(s) 493, 521, 605
BciT130I CCWGG 1 cut(s) 519
BfaI CTAG 3 cut(s) 363, 540, 618
BfoI RGCGCY 2 cut(s) 618, 653
BisI GCNGC 2 cut(s) 194, 215
BlsI GCNGC 2 cut(s) 195, 216
Bme1390I CCNGG 1 cut(s) 519
BmgT120I GGNCC 2 cut(s) 16, 503
BmiI GGNNCC 1 cut(s) 504
BmrFI CCNGG 1 cut(s) 519
BmsI GCATC 1 cut(s) 400
Bpu10I CCTNAGC 1 cut(s) 12
BpuEI CTTGAG 1 cut(s) 107
BsaJI CCNNGG 3 cut(s) 247, 419, 518
BsaXI ACNNNNNCTCC 2 cut(s) 564, 594
Bsc4I CCNNNNNNNGG 1 cut(s) 286
BseBI CCWGG 1 cut(s) 519
BseDI CCNNGG 3 cut(s) 247, 419, 518
BseGI GGATG 1 cut(s) 118
BseLI CCNNNNNNNGG 1 cut(s) 286
BseMII CTCAG 1 cut(s) 369
BseRI GAGGAG 3 cut(s) 341, 344, 590
BseXI GCAGC 2 cut(s) 201, 205
Bsh1236I CGCG 1 cut(s) 282
BshFI GGCC 3 cut(s) 17, 97, 505
BslI CCNNNNNNNGG 1 cut(s) 286
BsnI GGCC 3 cut(s) 17, 97, 505
Bsp143I GATC 2 cut(s) 226, 352
Bsp19I CCATGG 1 cut(s) 247
BspACI CCGC 2 cut(s) 162, 280
BspANI GGCC 3 cut(s) 17, 97, 505
BspCNI CTCAG 1 cut(s) 370
BspFNI CGCG 1 cut(s) 282
BspLI GGNNCC 1 cut(s) 504
BspPI GGATC 1 cut(s) 234
BssECI CCNNGG 3 cut(s) 247, 419, 518
BssMI GATC 2 cut(s) 226, 352
BssT1I CCWWGG 1 cut(s) 247
Bst2UI CCWGG 1 cut(s) 519
BstDEI CTNAG 2 cut(s) 12, 378
BstDSI CCRYGG 1 cut(s) 247
BstF5I GGATG 1 cut(s) 118
BstFNI CGCG 1 cut(s) 282
BstH2I RGCGCY 2 cut(s) 618, 653
BstHHI GCGC 2 cut(s) 617, 652
BstKTI GATC 2 cut(s) 229, 355
BstMBI GATC 2 cut(s) 226, 352
BstMWI GCNNNNNNNGC 1 cut(s) 502
BstNI CCWGG 1 cut(s) 519
BstSCI CCNGG 1 cut(s) 517
BstUI CGCG 1 cut(s) 282
BstV1I GCAGC 2 cut(s) 201, 205
BsuRI GGCC 3 cut(s) 17, 97, 505
BtgI CCRYGG 1 cut(s) 247
BtsCI GGATG 1 cut(s) 118
BtsIMutI CAGTG 2 cut(s) 29, 147
CfoI GCGC 2 cut(s) 617, 652
Cfr13I GGNCC 2 cut(s) 16, 503
Csp6I GTAC 1 cut(s) 122
CviAII CATG 2 cut(s) 210, 248
CviJI RGCY 9 cut(s) 11, 17, 97, 214, 344, 366, 460, 488, 505
CviKI_1 RGCY 9 cut(s) 11, 17, 97, 214, 344, 366, 460, 488, 505
CviQI GTAC 1 cut(s) 122
DdeI CTNAG 2 cut(s) 12, 378
DpnI GATC 2 cut(s) 228, 354
DpnII GATC 2 cut(s) 226, 352
DraI TTTAAA 1 cut(s) 633
Eco130I CCWWGG 1 cut(s) 247
Eco32I GATATC 1 cut(s) 478
Eco57I CTGAAG 2 cut(s) 5, 512
EcoO109I RGGNCCY 1 cut(s) 16
EcoRII CCWGG 1 cut(s) 517
EcoRV GATATC 1 cut(s) 478
EcoT14I CCWWGG 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 247
FaeI CATG 2 cut(s) 213, 251
FatI CATG 2 cut(s) 209, 247
FauNDI CATATG 1 cut(s) 393
Fnu4HI GCNGC 2 cut(s) 194, 215
FokI GGATG 1 cut(s) 125
Fsp4HI GCNGC 2 cut(s) 194, 215
FspBI CTAG 3 cut(s) 363, 540, 618
GlaI GCGC 2 cut(s) 616, 651
GluI GCNGC 2 cut(s) 194, 215
HaeII RGCGCY 2 cut(s) 618, 653
HaeIII GGCC 3 cut(s) 17, 97, 505
HhaI GCGC 2 cut(s) 617, 652
Hin1II CATG 2 cut(s) 213, 251
Hin6I GCGC 2 cut(s) 615, 650
HinP1I GCGC 2 cut(s) 615, 650
HinfI GANTC 3 cut(s) 179, 334, 543
HphI GGTGA 2 cut(s) 457, 507
Hpy166II GTNNAC 1 cut(s) 596
Hpy188I TCNGA 7 cut(s) 47, 339, 350, 379, 423, 492, 606
Hpy188III TCNNGA 2 cut(s) 110, 201
Hpy8I GTNNAC 1 cut(s) 596
HpyAV CCTTC 5 cut(s) 29, 123, 129, 215, 334
HpyCH4IV ACGT 1 cut(s) 554
HpyCH4V TGCA 2 cut(s) 217, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 502
HpyF3I CTNAG 2 cut(s) 12, 378
HpySE526I ACGT 1 cut(s) 554
Hsp92II CATG 2 cut(s) 213, 251
HspAI GCGC 2 cut(s) 615, 650
Kzo9I GATC 2 cut(s) 226, 352
LpnPI CCDG 7 cut(s) 95, 214, 298, 481, 504, 531, 563
Lsp1109I GCAGC 2 cut(s) 201, 205
LweI GCATC 1 cut(s) 400
MaeI CTAG 3 cut(s) 363, 540, 618
MaeII ACGT 1 cut(s) 554
MaeIII GTNAC 5 cut(s) 68, 145, 427, 513, 682
MalI GATC 2 cut(s) 228, 354
MboI GATC 2 cut(s) 226, 352
MboII GAAGA 3 cut(s) 285, 494, 536
MluCI AATT 7 cut(s) 63, 152, 171, 183, 239, 291, 449
MmeI TCCRAC 1 cut(s) 8
MroXI GAANNNNTTC 3 cut(s) 41, 344, 461
MseI TTAA 3 cut(s) 74, 294, 632
MslI CAYNNNNRTG 1 cut(s) 252
MspR9I CCNGG 1 cut(s) 519
MvaI CCWGG 1 cut(s) 519
MvnI CGCG 1 cut(s) 282
MwoI GCNNNNNNNGC 1 cut(s) 502
NcoI CCATGG 1 cut(s) 247
NdeI CATATG 1 cut(s) 393
NdeII GATC 2 cut(s) 226, 352
NlaIII CATG 2 cut(s) 213, 251
NlaIV GGNNCC 1 cut(s) 504
NmuCI GTSAC 4 cut(s) 68, 145, 513, 682
PdmI GAANNNNTTC 3 cut(s) 41, 344, 461
PfeI GAWTC 3 cut(s) 179, 334, 543
PkrI GCNGC 2 cut(s) 195, 216
PshBI ATTAAT 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 517
PspGI CCWGG 1 cut(s) 517
PspN4I GGNNCC 1 cut(s) 504
PspPI GGNCC 2 cut(s) 16, 503
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
RseI CAYNNNNRTG 1 cut(s) 252
SaqAI TTAA 3 cut(s) 74, 294, 632
SatI GCNGC 2 cut(s) 194, 215
Sau3AI GATC 2 cut(s) 226, 352
Sau96I GGNCC 2 cut(s) 16, 503
ScrFI CCNGG 1 cut(s) 519
SetI ASST 9 cut(s) 13, 44, 93, 271, 368, 490, 557, 582, 666
SfaNI GCATC 1 cut(s) 400
SmiMI CAYNNNNRTG 1 cut(s) 252
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
Sse9I AATT 7 cut(s) 63, 152, 171, 183, 239, 291, 449
SsiI CCGC 2 cut(s) 162, 280
SspMI CTAG 3 cut(s) 363, 540, 618
StyD4I CCNGG 1 cut(s) 517
StyI CCWWGG 1 cut(s) 247
TaiI ACGT 1 cut(s) 557
TaqI TCGA 1 cut(s) 480
TasI AATT 7 cut(s) 63, 152, 171, 183, 239, 291, 449
TatI WGTACW 1 cut(s) 121
TfiI GAWTC 3 cut(s) 179, 334, 543
Tru1I TTAA 3 cut(s) 74, 294, 632
Tru9I TTAA 3 cut(s) 74, 294, 632
TscAI CASTG 2 cut(s) 29, 154
TseFI GTSAC 4 cut(s) 68, 145, 513, 682
TseI GCWGC 2 cut(s) 193, 214
Tsp45I GTSAC 4 cut(s) 68, 145, 513, 682
TspDTI ATGAA 2 cut(s) 198, 455
TspGWI ACGGA 1 cut(s) 446
TspRI CASTG 2 cut(s) 29, 154
VspI ATTAAT 1 cut(s) 294
XapI RAATTY 2 cut(s) 63, 239
XmnI GAANNNNTTC 3 cut(s) 41, 344, 461
XspI CTAG 3 cut(s) 363, 540, 618
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.