Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001192.1

Orthogroup ID

OG0003174

Physical Location & Seq

Genomic Coordinates Forward (+)

107687 .. 112988

Gene Structure 5302 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001192.1_g000027.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1050 bp

atggaacgaaaccgaacccccgccgcagcagagccgaacaagaacaagagcgatcccgaaaaggtgaaggtaatcgaatgggaggaattcgagcaggaggttgccaggttgtggagtctgtcttctgcgctcaaggaagctcaggagaagaagcagagtcttaagcagaagctcgagtctctcattgaggttgaagctgagtcattgaatcgatcaaatgagcttgaggagatgcagcagaaactggaggcgagaaaagtggtaatgggaaacatgtccatgcattctatggttgccgtggaggatactaaaaagaacgagggacaacttagtacagaactaaggtcgctattggtcgctgggacagctctatccgcagctaggaagaaactggaggttgaagctgagtcattgaatcgatcaaatgagcttgaggagatgcagcagaaactggaggcgagaaaagtggtaatgggaaacatgtccatgcattctatggttgccgtggaggatactaaaaagaacgagggacagcttagtacagaactaaggtcgctattggtcgctgggacagctctatccgcagctaggaagaaactggaggagtcaaatcagctactttccagggacaatggatatattcgtcttaaaaacttgcaaaagatgctaagaagaagacaacaaaatatgataacacaagtttcattgctctatcctgtaaagttcactatgggtcctgcacacgaacaggagcttgaatcatttcctaacactagtagatcaggtaattctgctcgatttaaacctgcaaaccagggaacattgacaattttaggtttgcatttgactatgctgccttttaaaatgacaagtttcttcaccgacaagaaagaggttcagaagtctgcaacagccctgggatacgtcggtcatgatttagaacagcttctgaattacattggtgttaaaagcttagggccacggcatgtcctggccaatttgaaggagcttattaggacagttcagtctgtagattatattgatacgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 map04140

Pfam Domains

Protein Families

Atg14

Protein Analysis

349

Amino Acids

39.43

Weight (kDa)

8.96

Isoelectric Point (pI)

49.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003174)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G32760 AT2G32760 AT2G32760
fragaria_vesca	FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790 FvH4_4g13790
malus_domestica	MD00G1113200.v1.1 MD04G1010600.v1.1
prunus_persica	Prupe.1G010300_v2.0.a1 Prupe.1G010300_v2.0.a1 Prupe.1G010300_v2.0.a1
pyrus_communis	pycom04g00870 pycom420g01290
rosa_chinensis	RchiOBHm_Chr4g0414711
rosa_laevigata	RLG00000008122
rosa_multiflora	Rmu_sc0001192.1_g000027 Rmu_sc0010606.1_g000008
rosa_roxburghii	Rroxscaffold_5G00358520
rosa_rugosa	Rorug04G0129800 Rorug04G0129900 Rorug04G0130000 Rorug04G0130100 Rorug04G0130200 Rorug04G0130200 Rorug04G0130200
rosa_samantha	Rh4AG188300 Rh4BG187300 Rh4CG200600 Rh4DG187000
rosa_wichuraiana	Rw4G016070

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1024
Acc36I	ACCTGC	1 cut(s)	814
AccB7I	CCANNNNNTGG	1 cut(s)	111
AciI	CCGC	4 cut(s)	21, 24, 375, 582
AclWI	GGATC	1 cut(s)	47
AcoI	YGGCCR	1 cut(s)	993
AcsI	RAATTY	1 cut(s)	86
AfaI	GTAC	2 cut(s)	334, 541
AfiI	CCNNNNNNNGG	3 cut(s)	111, 381, 588
AflII	CTTAAG	1 cut(s)	161
AflIII	ACRYGT	2 cut(s)	273, 480
AgsI	TTSAA	6 cut(s)	194, 208, 401, 415, 758, 1003
AhlI	ACTAGT	1 cut(s)	773
AjnI	CCWGG	5 cut(s)	104, 623, 813, 915, 990
Alw26I	GTCTC	1 cut(s)	183
AlwI	GGATC	1 cut(s)	47
AlwNI	CAGNNNCTG	3 cut(s)	244, 451, 949
Ama87I	CYCGRG	1 cut(s)	173
AoxI	GGCC	2 cut(s)	977, 993
ApeKI	GCWGC	6 cut(s)	26, 235, 377, 442, 584, 853
ApoI	RAATTY	1 cut(s)	86
Asp700I	GAANNNNTTC	2 cut(s)	762, 945
AspLEI	GCGC	1 cut(s)	130
AspS9I	GGNCC	2 cut(s)	734, 977
AsuHPI	GGTGA	2 cut(s)	76, 871
AvaI	CYCGRG	1 cut(s)	173
AvaII	GGWCC	1 cut(s)	734
BaeI	ACNNNNGTAYC	2 cut(s)	913, 946
BalI	TGGCCA	1 cut(s)	995
BbsI	GAAGAC	2 cut(s)	114, 682
BbvI	GCAGC	6 cut(s)	38, 247, 389, 454, 596, 840
BceAI	ACGGC	3 cut(s)	281, 488, 998
BciT130I	CCWGG	5 cut(s)	106, 625, 815, 917, 992
BciVI	GTATCC	3 cut(s)	298, 505, 914
BcoDI	GTCTC	1 cut(s)	183
BcuI	ACTAGT	1 cut(s)	773
BfaI	CTAG	3 cut(s)	381, 588, 774
BfmI	CTRYAG	1 cut(s)	1029
BfrI	CTTAAG	1 cut(s)	161
BfuAI	ACCTGC	1 cut(s)	814
BfuI	GTATCC	3 cut(s)	298, 505, 914
BisI	GCNGC	7 cut(s)	24, 27, 236, 378, 443, 585, 854
BlsI	GCNGC	7 cut(s)	25, 28, 237, 379, 444, 586, 855
Bme1390I	CCNGG	5 cut(s)	106, 625, 815, 917, 992
Bme18I	GGWCC	1 cut(s)	734
BmeT110I	CYCGRG	1 cut(s)	173
BmgT120I	GGNCC	2 cut(s)	734, 977
BmiI	GGNNCC	1 cut(s)	735
BmrFI	CCNGG	5 cut(s)	106, 625, 815, 917, 992
BmsI	GCATC	3 cut(s)	222, 429, 654
BpiI	GAAGAC	2 cut(s)	114, 682
BpmI	CTGGAG	4 cut(s)	266, 413, 473, 620
Bpu10I	CCTNAGC	2 cut(s)	141, 973
BpuEI	CTTGAG	3 cut(s)	116, 245, 452
Bsa29I	ATCGAT	2 cut(s)	211, 418
BsaAI	YACGTR	1 cut(s)	1047
BsaJI	CCNNGG	7 cut(s)	297, 504, 624, 814, 915, 916, 980
Bsc4I	CCNNNNNNNGG	3 cut(s)	111, 381, 588
Bse1I	ACTGG	4 cut(s)	249, 396, 456, 603
Bse3DI	GCAATG	1 cut(s)	704
BseBI	CCWGG	5 cut(s)	106, 625, 815, 917, 992
BseCI	ATCGAT	2 cut(s)	211, 418
BseDI	CCNNGG	7 cut(s)	297, 504, 624, 814, 915, 916, 980
BseLI	CCNNNNNNNGG	3 cut(s)	111, 381, 588
BseMI	GCAATG	1 cut(s)	704
BseMII	CTCAG	3 cut(s)	155, 189, 396
BseNI	ACTGG	4 cut(s)	249, 396, 456, 603
BseRI	GAGGAG	3 cut(s)	242, 449, 617
BseXI	GCAGC	6 cut(s)	38, 247, 389, 454, 596, 840
BseYI	CCCAGC	2 cut(s)	359, 566
BsgI	GTGCAG	1 cut(s)	723
BshFI	GGCC	2 cut(s)	979, 995
BshVI	ATCGAT	2 cut(s)	211, 418
BsiHKCI	CYCGRG	1 cut(s)	173
BslFI	GGGAC	5 cut(s)	336, 376, 543, 583, 641
BslI	CCNNNNNNNGG	3 cut(s)	111, 381, 588
BsmAI	GTCTC	1 cut(s)	183
BsmFI	GGGAC	5 cut(s)	336, 376, 543, 583, 641
BsmI	GAATGC	2 cut(s)	283, 490
BsnI	GGCC	2 cut(s)	979, 995
BsoBI	CYCGRG	1 cut(s)	173
Bsp143I	GATC	4 cut(s)	52, 212, 419, 779
BspACI	CCGC	4 cut(s)	21, 24, 375, 582
BspANI	GGCC	2 cut(s)	979, 995
BspCNI	CTCAG	3 cut(s)	154, 190, 397
BspDI	ATCGAT	2 cut(s)	211, 418
BspHI	TCATGA	1 cut(s)	931
BspLI	GGNNCC	1 cut(s)	735
BspMI	ACCTGC	1 cut(s)	814
BspPI	GGATC	1 cut(s)	47
BspTI	CTTAAG	1 cut(s)	161
BsrDI	GCAATG	1 cut(s)	704
BsrI	ACTGG	4 cut(s)	249, 396, 456, 603
BssECI	CCNNGG	7 cut(s)	297, 504, 624, 814, 915, 916, 980
BssMI	GATC	4 cut(s)	52, 212, 419, 779
Bst2UI	CCWGG	5 cut(s)	106, 625, 815, 917, 992
Bst4CI	ACNGT	1 cut(s)	1021
BstAFI	CTTAAG	1 cut(s)	161
BstAPI	GCANNNNNTGC	1 cut(s)	664
BstBAI	YACGTR	1 cut(s)	1047
BstDEI	CTNAG	9 cut(s)	141, 198, 329, 341, 405, 536, 548, 668, 973
BstDSI	CCRYGG	3 cut(s)	297, 504, 980
BstHHI	GCGC	1 cut(s)	130
BstKTI	GATC	4 cut(s)	55, 215, 422, 782
BstMAI	GTCTC	1 cut(s)	183
BstMBI	GATC	4 cut(s)	52, 212, 419, 779
BstMWI	GCNNNNNNNGC	5 cut(s)	365, 374, 572, 581, 664
BstNI	CCWGG	5 cut(s)	106, 625, 815, 917, 992
BstNSI	RCATGY	3 cut(s)	277, 484, 989
BstSCI	CCNGG	5 cut(s)	104, 623, 813, 915, 990
BstSFI	CTRYAG	1 cut(s)	1029
BstV1I	GCAGC	6 cut(s)	38, 247, 389, 454, 596, 840
BstV2I	GAAGAC	2 cut(s)	114, 682
Bsu15I	ATCGAT	2 cut(s)	211, 418
BsuI	GTATCC	3 cut(s)	298, 505, 914
BsuRI	GGCC	2 cut(s)	979, 995
BsuTUI	ATCGAT	2 cut(s)	211, 418
BtgI	CCRYGG	3 cut(s)	297, 504, 980
BveI	ACCTGC	1 cut(s)	814
CaiI	CAGNNNCTG	3 cut(s)	244, 451, 949
CciI	TCATGA	1 cut(s)	931
CfoI	GCGC	1 cut(s)	130
Cfr13I	GGNCC	2 cut(s)	734, 977
ClaI	ATCGAT	2 cut(s)	211, 418
Csp6I	GTAC	2 cut(s)	333, 540
CviAII	CATG	6 cut(s)	274, 280, 481, 487, 932, 986
CviQI	GTAC	2 cut(s)	333, 540
DdeI	CTNAG	9 cut(s)	141, 198, 329, 341, 405, 536, 548, 668, 973
DpnI	GATC	4 cut(s)	54, 214, 421, 781
DpnII	GATC	4 cut(s)	52, 212, 419, 779
DraI	TTTAAA	2 cut(s)	802, 862
DrdI	GACNNNNNNGTC	1 cut(s)	1024
DseDI	GACNNNNNNGTC	1 cut(s)	1024
EaeI	YGGCCR	1 cut(s)	993
Eco47I	GGWCC	1 cut(s)	734
Eco88I	CYCGRG	1 cut(s)	173
EcoO109I	RGGNCCY	1 cut(s)	734
EcoRI	GAATTC	1 cut(s)	86
EcoRII	CCWGG	5 cut(s)	104, 623, 813, 915, 990
EcoT22I	ATGCAT	2 cut(s)	285, 492
FaeI	CATG	6 cut(s)	277, 283, 484, 490, 935, 989
FaqI	GGGAC	5 cut(s)	336, 376, 543, 583, 641
FatI	CATG	6 cut(s)	273, 279, 480, 486, 931, 985
FauI	CCCGC	1 cut(s)	28
Fnu4HI	GCNGC	7 cut(s)	24, 27, 236, 378, 443, 585, 854
Fsp4HI	GCNGC	7 cut(s)	24, 27, 236, 378, 443, 585, 854
FspBI	CTAG	3 cut(s)	381, 588, 774
GlaI	GCGC	1 cut(s)	129
GluI	GCNGC	7 cut(s)	24, 27, 236, 378, 443, 585, 854
GsaI	CCCAGC	2 cut(s)	363, 570
GsuI	CTGGAG	4 cut(s)	266, 413, 473, 620
HaeIII	GGCC	2 cut(s)	979, 995
HhaI	GCGC	1 cut(s)	130
Hin1II	CATG	6 cut(s)	277, 283, 484, 490, 935, 989
Hin6I	GCGC	1 cut(s)	128
HinP1I	GCGC	1 cut(s)	128
HindIII	AAGCTT	1 cut(s)	970
HinfI	GANTC	9 cut(s)	115, 157, 176, 200, 208, 407, 415, 605, 758
HphI	GGTGA	2 cut(s)	76, 871
Hpy166II	GTNNAC	1 cut(s)	726
Hpy188I	TCNGA	2 cut(s)	900, 951
Hpy188III	TCNNGA	3 cut(s)	56, 143, 932
Hpy8I	GTNNAC	1 cut(s)	726
Hpy99I	CGWCG	1 cut(s)	929
HpyAV	CCTTC	2 cut(s)	61, 997
HpyCH4III	ACNGT	1 cut(s)	1021
HpyCH4IV	ACGT	2 cut(s)	924, 1046
HpyCH4V	TGCA	9 cut(s)	235, 283, 442, 490, 658, 740, 809, 841, 908
HpyF10VI	GCNNNNNNNGC	5 cut(s)	365, 374, 572, 581, 664
HpyF3I	CTNAG	9 cut(s)	141, 198, 329, 341, 405, 536, 548, 668, 973
HpySE526I	ACGT	2 cut(s)	924, 1046
Hsp92II	CATG	6 cut(s)	277, 283, 484, 490, 935, 989
HspAI	GCGC	1 cut(s)	128
Kzo9I	GATC	4 cut(s)	52, 212, 419, 779
LmnI	GCTCC	2 cut(s)	751, 1006
Lsp1109I	GCAGC	6 cut(s)	38, 247, 389, 454, 596, 840
LweI	GCATC	3 cut(s)	222, 429, 654
MaeI	CTAG	3 cut(s)	381, 588, 774
MaeII	ACGT	2 cut(s)	924, 1046
MalI	GATC	4 cut(s)	54, 214, 421, 781
MboI	GATC	4 cut(s)	52, 212, 419, 779
MboII	GAAGA	7 cut(s)	114, 160, 397, 604, 684, 687, 868
MlsI	TGGCCA	1 cut(s)	995
MluCI	AATT	5 cut(s)	86, 787, 828, 952, 997
MluNI	TGGCCA	1 cut(s)	995
MlyI	GAGTC	6 cut(s)	124, 166, 185, 209, 416, 614
Mox20I	TGGCCA	1 cut(s)	995
Mph1103I	ATGCAT	2 cut(s)	285, 492
MroXI	GAANNNNTTC	2 cut(s)	762, 945
MscI	TGGCCA	1 cut(s)	995
MseI	TTAA	5 cut(s)	162, 648, 801, 861, 966
MslI	CAYNNNNRTG	2 cut(s)	278, 485
Msp20I	TGGCCA	1 cut(s)	995
MspCI	CTTAAG	1 cut(s)	161
MspR9I	CCNGG	5 cut(s)	106, 625, 815, 917, 992
Mva1269I	GAATGC	2 cut(s)	283, 490
MvaI	CCWGG	5 cut(s)	106, 625, 815, 917, 992
MwoI	GCNNNNNNNGC	5 cut(s)	365, 374, 572, 581, 664
NdeII	GATC	4 cut(s)	52, 212, 419, 779
NlaIII	CATG	6 cut(s)	277, 283, 484, 490, 935, 989
NlaIV	GGNNCC	1 cut(s)	735
NsiI	ATGCAT	2 cut(s)	285, 492
NspI	RCATGY	3 cut(s)	277, 484, 989
PaeR7I	CTCGAG	1 cut(s)	173
PagI	TCATGA	1 cut(s)	931
PasI	CCCWGGG	1 cut(s)	916
PciI	ACATGT	2 cut(s)	273, 480
PctI	GAATGC	2 cut(s)	283, 490
PdmI	GAANNNNTTC	2 cut(s)	762, 945
PfeI	GAWTC	3 cut(s)	208, 415, 758
PflMI	CCANNNNNTGG	1 cut(s)	111
PkrI	GCNGC	7 cut(s)	25, 28, 237, 379, 444, 586, 855
PleI	GAGTC	6 cut(s)	123, 165, 184, 208, 415, 613
PpsI	GAGTC	6 cut(s)	123, 165, 184, 208, 415, 613
Ppu21I	YACGTR	1 cut(s)	1047
PpuMI	RGGWCCY	1 cut(s)	734
PscI	ACATGT	2 cut(s)	273, 480
Psp5II	RGGWCCY	1 cut(s)	734
Psp6I	CCWGG	5 cut(s)	104, 623, 813, 915, 990
PspFI	CCCAGC	2 cut(s)	359, 566
PspGI	CCWGG	5 cut(s)	104, 623, 813, 915, 990
PspN4I	GGNNCC	1 cut(s)	735
PspPI	GGNCC	2 cut(s)	734, 977
PspPPI	RGGWCCY	1 cut(s)	734
PspXI	VCTCGAGB	1 cut(s)	173
PstNI	CAGNNNCTG	3 cut(s)	244, 451, 949
RsaI	GTAC	2 cut(s)	334, 541
RsaNI	GTAC	2 cut(s)	333, 540
RseI	CAYNNNNRTG	2 cut(s)	278, 485
SaqAI	TTAA	5 cut(s)	162, 648, 801, 861, 966
SatI	GCNGC	7 cut(s)	24, 27, 236, 378, 443, 585, 854
Sau3AI	GATC	4 cut(s)	52, 212, 419, 779
Sau96I	GGNCC	2 cut(s)	734, 977
SchI	GAGTC	6 cut(s)	124, 166, 185, 209, 416, 614
ScrFI	CCNGG	5 cut(s)	106, 625, 815, 917, 992
SfaNI	GCATC	3 cut(s)	222, 429, 654
SfcI	CTRYAG	1 cut(s)	1029
Sfr274I	CTCGAG	1 cut(s)	173
SinI	GGWCC	1 cut(s)	734
SlaI	CTCGAG	1 cut(s)	173
SmiMI	CAYNNNNRTG	2 cut(s)	278, 485
SmlI	CTYRAG	5 cut(s)	131, 161, 173, 224, 431
SmoI	CTYRAG	5 cut(s)	131, 161, 173, 224, 431
SpeI	ACTAGT	1 cut(s)	773
Sse9I	AATT	5 cut(s)	86, 787, 828, 952, 997
SsiI	CCGC	4 cut(s)	21, 24, 375, 582
SspMI	CTAG	3 cut(s)	381, 588, 774
StyD4I	CCNGG	5 cut(s)	104, 623, 813, 915, 990
TaaI	ACNGT	1 cut(s)	1021
TaiI	ACGT	2 cut(s)	927, 1049
TaqI	TCGA	6 cut(s)	75, 90, 174, 211, 418, 796
TaqII	GACCGA	1 cut(s)	917
TasI	AATT	5 cut(s)	86, 787, 828, 952, 997
TatI	WGTACW	2 cut(s)	332, 539
TauI	GCSGC	1 cut(s)	26
TfiI	GAWTC	3 cut(s)	208, 415, 758
Tru1I	TTAA	5 cut(s)	162, 648, 801, 861, 966
Tru9I	TTAA	5 cut(s)	162, 648, 801, 861, 966
TseI	GCWGC	6 cut(s)	26, 235, 377, 442, 584, 853
TspDTI	ATGAA	1 cut(s)	693
Van91I	CCANNNNNTGG	1 cut(s)	111
Vha464I	CTTAAG	1 cut(s)	161
VpaK11BI	GGWCC	1 cut(s)	734
XapI	RAATTY	1 cut(s)	86
XceI	RCATGY	3 cut(s)	277, 484, 989
XcmI	CCANNNNNNNNNTGG	2 cut(s)	286, 493
XhoI	CTCGAG	1 cut(s)	173
XmnI	GAANNNNTTC	2 cut(s)	762, 945
XspI	CTAG	3 cut(s)	381, 588, 774
Zsp2I	ATGCAT	2 cut(s)	285, 492

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.