Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001231.1

Orthogroup ID

OG0006926

Physical Location & Seq

Genomic Coordinates Reverse (-)

26534 .. 28100

Gene Structure 1567 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001231.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1092 bp

atggaagtctccggtgaaactcaatctgctgaatacaaccgagctcaagaggtaaagagtttcgatgatacgaaggctggagtcaaaggccttgtagatgcaggcataggcaaagtcccaaagatattcatagcaccatctaatgatcatgctgattttccaacatgtcagcaaccaaatttgcaaattcctgtcataaatcttggtggcctctacggtgatcgccacaaggagattgttaatgaagttcggattgcatccgagacatggggtttcttccaagtggtcaatcatggagttccattgaatgtgcttgaagatatgatccaaggcgtaaggaggtttaacgagcaagatcttgaggcgaagaaagagttctatagtcgtgatctaatgagaactgtgagattcaacagcaattacgatctctaccagtcaaaagcagctaattggagggacactttggcttttaccaagcccgcagttgatcatgaaccccaagaactccctcaagtttgtagagaagtagcacttgagtacacaaaccatgtcatagagttggcagatcaactctttggattgttatcagaggctctggaactcaaaccggattacctaacaagggaaatggagtgtgctaagttttatgcctgtgtctgccactactatccagcatgccctgaaccagagctaactttgggagctagcaagcattcagatccagcgttcctcacaattcttcttcaagacaaaatcggcggccttcaagtccttcatgacaatcagtgggttaacgttgaccccatttcaggaggcttagtaataaacataggggactttctccaggccatatcaaatgacaggctcaagagtgttcaacatagagtgctcaccaaccgtgtcggtccacgagtttccgtagcttatttttttaaaggagagactgctgccaagtcttatggtccgatcaaagagctcatatcagatgaaaaccctcctctctacaaggatttctccatagatgagtatcatcgcaagttcttttctcaagggcttgatgagaagtcaggacttgaccagttcaagctatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

363

Amino Acids

41.03

Weight (kDa)

5.22

Isoelectric Point (pI)

34.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006926)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g03310
malus_domestica	MD05G1014300.v1.1 MD13G1212100.v1.1
prunus_persica	Prupe.1G037000_v2.0.a1 Prupe.1G037000_v2.0.a1 Prupe.1G037000_v2.0.a1
pyrus_communis	pycom13g18390 pycom16g18030
rosa_chinensis	RchiOBHm_Chr4g0392321 RchiOBHm_Chr4g0392351
rosa_laevigata	RLG00000009818
rosa_multiflora	Rmu_sc0001231.1_g000012 Rmu_sc0001231.1_g000019
rosa_roxburghii	Rroxscaffold_5G00337490 Rroxscaffold_5G00337530
rosa_rugosa	Rorug03G0338300
rosa_samantha	Rh4AG041700 Rh4AG042000 Rh4BG036600 Rh4BG036900 Rh4CG044300 Rh4CG044600 Rh4CG044800 Rh4DG039000
rosa_wichuraiana	Rw4G003230 Rw4G003250

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	480, 759
AclI	AACGTT	1 cut(s)	795
AclWI	GGATC	2 cut(s)	319, 713
AcsI	RAATTY	2 cut(s)	178, 186
AfaI	GTAC	1 cut(s)	539
AfiI	CCNNNNNNNGG	3 cut(s)	267, 622, 809
AflIII	ACRYGT	1 cut(s)	164
AgsI	TTSAA	7 cut(s)	307, 317, 412, 746, 767, 878, 1084
AjnI	CCWGG	1 cut(s)	843
AluBI	AGCT	7 cut(s)	44, 446, 691, 704, 923, 976, 1087
AluI	AGCT	7 cut(s)	44, 446, 691, 704, 923, 976, 1087
Alw21I	GWGCWC	3 cut(s)	46, 891, 978
Alw26I	GTCTC	3 cut(s)	13, 257, 935
AlwI	GGATC	2 cut(s)	319, 713
AoxI	GGCC	4 cut(s)	88, 208, 760, 846
ApeKI	GCWGC	2 cut(s)	443, 947
ApoI	RAATTY	2 cut(s)	178, 186
Asp700I	GAANNNNTTC	1 cut(s)	374
AspS9I	GGNCC	2 cut(s)	905, 962
AsuHPI	GGTGA	3 cut(s)	26, 230, 883
AsuNHI	GCTAGC	1 cut(s)	704
AvaII	GGWCC	2 cut(s)	905, 962
BanII	GRGCYC	2 cut(s)	46, 978
BauI	CACGAG	1 cut(s)	909
Bbv12I	GWGCWC	3 cut(s)	46, 891, 978
BbvI	GCAGC	2 cut(s)	455, 934
BccI	CCATC	1 cut(s)	145
BciT130I	CCWGG	1 cut(s)	845
BclI	TGATCA	2 cut(s)	145, 487
BcoDI	GTCTC	3 cut(s)	13, 257, 935
BfaI	CTAG	1 cut(s)	705
BfmI	CTRYAG	1 cut(s)	379
BglII	AGATCT	1 cut(s)	355
BisI	GCNGC	3 cut(s)	444, 760, 948
BlsI	GCNGC	3 cut(s)	445, 761, 949
Bme1390I	CCNGG	1 cut(s)	845
Bme18I	GGWCC	2 cut(s)	905, 962
BmgT120I	GGNCC	2 cut(s)	905, 962
BmrFI	CCNGG	1 cut(s)	845
BmsI	GCATC	2 cut(s)	88, 266
BmtI	GCTAGC	1 cut(s)	708
BpmI	CTGGAG	2 cut(s)	99, 827
BpuEI	CTTGAG	6 cut(s)	30, 380, 495, 554, 851, 1032
BsaBI	GATNNNNATC	2 cut(s)	583, 1026
BsaJI	CCNNGG	1 cut(s)	328
BsaWI	WCCGGW	2 cut(s)	11, 607
BsaXI	ACNNNNNCTCC	2 cut(s)	804, 834
Bsc4I	CCNNNNNNNGG	3 cut(s)	267, 622, 809
Bse1I	ACTGG	2 cut(s)	433, 1078
Bse8I	GATNNNNATC	2 cut(s)	583, 1026
BseBI	CCWGG	1 cut(s)	845
BseDI	CCNNGG	1 cut(s)	328
BseGI	GGATG	1 cut(s)	257
BseJI	GATNNNNATC	2 cut(s)	583, 1026
BseLI	CCNNNNNNNGG	3 cut(s)	267, 622, 809
BseNI	ACTGG	2 cut(s)	433, 1078
BseRI	GAGGAG	1 cut(s)	987
BseXI	GCAGC	2 cut(s)	455, 934
BshFI	GGCC	4 cut(s)	90, 210, 762, 848
BsiHKAI	GWGCWC	3 cut(s)	46, 891, 978
BsiSI	CCGG	2 cut(s)	12, 608
BslFI	GGGAC	3 cut(s)	101, 470, 848
BslI	CCNNNNNNNGG	3 cut(s)	267, 622, 809
BsmAI	GTCTC	3 cut(s)	13, 257, 935
BsmFI	GGGAC	3 cut(s)	101, 470, 848
BsmI	GAATGC	1 cut(s)	712
BsnI	GGCC	4 cut(s)	90, 210, 762, 848
Bsp1286I	GDGCHC	3 cut(s)	46, 891, 978
BspACI	CCGC	2 cut(s)	480, 759
BspANI	GGCC	4 cut(s)	90, 210, 762, 848
BspHI	TCATGA	2 cut(s)	490, 775
BspOI	GCTAGC	1 cut(s)	708
BspPI	GGATC	2 cut(s)	319, 713
BsrI	ACTGG	2 cut(s)	433, 1078
BssECI	CCNNGG	1 cut(s)	328
BssSI	CACGAG	1 cut(s)	909
BssT1I	CCWWGG	1 cut(s)	328
Bst2BI	CACGAG	1 cut(s)	909
Bst2UI	CCWGG	1 cut(s)	845
Bst4CI	ACNGT	3 cut(s)	218, 403, 899
BstC8I	GCNNGC	5 cut(s)	103, 480, 676, 706, 710
BstDEI	CTNAG	2 cut(s)	639, 817
BstF5I	GGATG	1 cut(s)	257
BstMAI	GTCTC	3 cut(s)	13, 257, 935
BstNI	CCWGG	1 cut(s)	845
BstNSI	RCATGY	2 cut(s)	168, 678
BstSCI	CCNGG	1 cut(s)	843
BstSFI	CTRYAG	1 cut(s)	379
BstV1I	GCAGC	2 cut(s)	455, 934
BstX2I	RGATCY	2 cut(s)	355, 718
BstYI	RGATCY	2 cut(s)	355, 718
BsuRI	GGCC	4 cut(s)	90, 210, 762, 848
BtgZI	GCGATG	1 cut(s)	1016
BtsCI	GGATG	1 cut(s)	257
BtsIMutI	CAGTG	1 cut(s)	791
Cac8I	GCNNGC	5 cut(s)	103, 480, 676, 706, 710
CciI	TCATGA	2 cut(s)	490, 775
Cfr13I	GGNCC	2 cut(s)	905, 962
Csp6I	GTAC	1 cut(s)	538
CviAII	CATG	8 cut(s)	149, 165, 267, 293, 491, 548, 675, 776
CviQI	GTAC	1 cut(s)	538
DdeI	CTNAG	2 cut(s)	639, 817
DraI	TTTAAA	1 cut(s)	934
Ecl136II	GAGCTC	2 cut(s)	44, 976
Eco130I	CCWWGG	1 cut(s)	328
Eco147I	AGGCCT	1 cut(s)	90
Eco24I	GRGCYC	2 cut(s)	46, 978
Eco47I	GGWCC	2 cut(s)	905, 962
Eco53kI	GAGCTC	2 cut(s)	44, 976
EcoICRI	GAGCTC	2 cut(s)	44, 976
EcoRII	CCWGG	1 cut(s)	843
EcoT14I	CCWWGG	1 cut(s)	328
EcoT38I	GRGCYC	2 cut(s)	46, 978
ErhI	CCWWGG	1 cut(s)	328
FaeI	CATG	8 cut(s)	152, 168, 270, 296, 494, 551, 678, 779
FalI	AAGNNNNNCTT	2 cut(s)	516, 548
FaqI	GGGAC	3 cut(s)	101, 470, 848
FatI	CATG	8 cut(s)	148, 164, 266, 292, 490, 547, 674, 775
FauI	CCCGC	1 cut(s)	487
FbaI	TGATCA	2 cut(s)	145, 487
Fnu4HI	GCNGC	3 cut(s)	444, 760, 948
FokI	GGATG	1 cut(s)	244
FriOI	GRGCYC	2 cut(s)	46, 978
Fsp4HI	GCNGC	3 cut(s)	444, 760, 948
FspBI	CTAG	1 cut(s)	705
GluI	GCNGC	3 cut(s)	444, 760, 948
GsuI	CTGGAG	2 cut(s)	99, 827
HaeIII	GGCC	4 cut(s)	90, 210, 762, 848
HapII	CCGG	2 cut(s)	12, 608
Hin1II	CATG	8 cut(s)	152, 168, 270, 296, 494, 551, 678, 779
HincII	GTYRAC	2 cut(s)	793, 799
HindII	GTYRAC	2 cut(s)	793, 799
HinfI	GANTC	2 cut(s)	81, 408
HpaI	GTTAAC	1 cut(s)	793
HpaII	CCGG	2 cut(s)	12, 608
HphI	GGTGA	3 cut(s)	26, 230, 883
Hpy166II	GTNNAC	4 cut(s)	540, 793, 799, 908
Hpy188I	TCNGA	6 cut(s)	252, 262, 589, 718, 966, 985
Hpy8I	GTNNAC	4 cut(s)	540, 793, 799, 908
HpyAV	CCTTC	3 cut(s)	67, 773, 782
HpyCH4III	ACNGT	3 cut(s)	218, 403, 899
HpyCH4IV	ACGT	1 cut(s)	795
HpyCH4V	TGCA	3 cut(s)	101, 184, 257
HpyF3I	CTNAG	2 cut(s)	639, 817
HpySE526I	ACGT	1 cut(s)	795
Hsp92II	CATG	8 cut(s)	152, 168, 270, 296, 494, 551, 678, 779
Ksp22I	TGATCA	2 cut(s)	145, 487
KspAI	GTTAAC	1 cut(s)	793
LmnI	GCTCC	1 cut(s)	701
Lsp1109I	GCAGC	2 cut(s)	455, 934
LweI	GCATC	2 cut(s)	88, 266
MaeI	CTAG	1 cut(s)	705
MaeII	ACGT	1 cut(s)	795
MboII	GAAGA	5 cut(s)	268, 329, 379, 731, 734
MflI	RGATCY	2 cut(s)	355, 718
MhlI	GDGCHC	3 cut(s)	46, 891, 978
MluCI	AATT	5 cut(s)	178, 186, 418, 448, 735
MlyI	GAGTC	1 cut(s)	90
MmeI	TCCRAC	1 cut(s)	185
MroXI	GAANNNNTTC	1 cut(s)	374
MseI	TTAA	4 cut(s)	240, 345, 792, 933
MspI	CCGG	2 cut(s)	12, 608
MspR9I	CCNGG	1 cut(s)	845
Mva1269I	GAATGC	1 cut(s)	712
MvaI	CCWGG	1 cut(s)	845
NheI	GCTAGC	1 cut(s)	704
NlaIII	CATG	8 cut(s)	152, 168, 270, 296, 494, 551, 678, 779
NspI	RCATGY	2 cut(s)	168, 678
PaeI	GCATGC	1 cut(s)	678
PagI	TCATGA	2 cut(s)	490, 775
PceI	AGGCCT	1 cut(s)	90
PciI	ACATGT	1 cut(s)	164
PctI	GAATGC	1 cut(s)	712
PdmI	GAANNNNTTC	1 cut(s)	374
PfeI	GAWTC	1 cut(s)	408
PkrI	GCNGC	3 cut(s)	445, 761, 949
PleI	GAGTC	1 cut(s)	89
PpsI	GAGTC	1 cut(s)	89
PscI	ACATGT	1 cut(s)	164
Psp124BI	GAGCTC	2 cut(s)	46, 978
Psp1406I	AACGTT	1 cut(s)	795
Psp6I	CCWGG	1 cut(s)	843
PspGI	CCWGG	1 cut(s)	843
PspPI	GGNCC	2 cut(s)	905, 962
PsuI	RGATCY	2 cut(s)	355, 718
RsaI	GTAC	1 cut(s)	539
RsaNI	GTAC	1 cut(s)	538
SacI	GAGCTC	2 cut(s)	46, 978
SaqAI	TTAA	4 cut(s)	240, 345, 792, 933
SatI	GCNGC	3 cut(s)	444, 760, 948
Sau96I	GGNCC	2 cut(s)	905, 962
SchI	GAGTC	1 cut(s)	90
ScrFI	CCNGG	1 cut(s)	845
SduI	GDGCHC	3 cut(s)	46, 891, 978
SfaNI	GCATC	2 cut(s)	88, 266
SfcI	CTRYAG	1 cut(s)	379
SinI	GGWCC	2 cut(s)	905, 962
SmlI	CTYRAG	6 cut(s)	45, 359, 510, 533, 866, 1047
SmoI	CTYRAG	6 cut(s)	45, 359, 510, 533, 866, 1047
SphI	GCATGC	1 cut(s)	678
Sse9I	AATT	5 cut(s)	178, 186, 418, 448, 735
SseBI	AGGCCT	1 cut(s)	90
SsiI	CCGC	2 cut(s)	480, 759
SspMI	CTAG	1 cut(s)	705
SstI	GAGCTC	2 cut(s)	46, 978
StuI	AGGCCT	1 cut(s)	90
StyD4I	CCNGG	1 cut(s)	843
StyI	CCWWGG	1 cut(s)	328
TaaI	ACNGT	3 cut(s)	218, 403, 899
TaiI	ACGT	1 cut(s)	798
TaqI	TCGA	1 cut(s)	63
TaqII	GACCGA	1 cut(s)	893
TasI	AATT	5 cut(s)	178, 186, 418, 448, 735
TatI	WGTACW	1 cut(s)	537
TauI	GCSGC	1 cut(s)	762
TfiI	GAWTC	1 cut(s)	408
Tru1I	TTAA	4 cut(s)	240, 345, 792, 933
Tru9I	TTAA	4 cut(s)	240, 345, 792, 933
TscAI	CASTG	1 cut(s)	791
TseI	GCWGC	2 cut(s)	443, 947
TspDTI	ATGAA	5 cut(s)	118, 258, 507, 764, 1002
TspGWI	ACGGA	1 cut(s)	907
TspRI	CASTG	1 cut(s)	791
VpaK11BI	GGWCC	2 cut(s)	905, 962
XapI	RAATTY	2 cut(s)	178, 186
XceI	RCATGY	2 cut(s)	168, 678
XmnI	GAANNNNTTC	1 cut(s)	374
XspI	CTAG	1 cut(s)	705

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.