Rmu_sc0001288.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001288.1
Physical Location & Seq
Reverse (-)
6366 .. 7013
648 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001288.1_g000002.1.cds

Sequence Viewer

Length: 648 bp
atgtgccctccaccagtcccagtgtacaagaagccactccctccaccagtccctgtatacaagaagccactccctccaccagtccctgtatacaaaaagccactcccaccaccagtccctgtgtataaaaagccactcccaccaccagttccagtttacaaaaagccactcccaccacctgttcccgtgtacacaaaaccgcttccaccgccggttcctgtgtacacaaaaccgctcccaccaccggtcccagtgtacacaaaaccactcccacctccaatcccattttacaaaccaaagccacacccattttacaaaccaaaaccacttccacctccaattccattttacaaaccaaagccacacccatggttcaaaccaaagccacttccacctccaattccattttacaaaccaaagccacacccatggttcaagccaaagccacacccattttacaaaccaaaaccgcttccacctccaatcccattttacaaaccaaagccacacccatggttcaagccaaagccacacccatttttcaagcacccattcttgaagcctctacctccattccccaagattcctcatcatcctttctttaagaaaccaccaccattcccactacaaacatctcccaaggtttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

215

Amino Acids

24.82

Weight (kDa)

10.34

Isoelectric Point (pI)

70.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010868)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 235
AccI GTMKAC 2 cut(s) 57, 90
AciI CCGC 4 cut(s) 200, 209, 233, 470
AfaI GTAC 4 cut(s) 26, 191, 224, 257
AfiI CCNNNNNNNGG 1 cut(s) 244
AgeI ACCGGT 1 cut(s) 244
AgsI TTSAA 5 cut(s) 376, 436, 520, 544, 559
AlwNI CAGNNNCTG 3 cut(s) 53, 86, 119
AsiGI ACCGGT 1 cut(s) 244
AspS9I GGNCC 1 cut(s) 247
AvaII GGWCC 1 cut(s) 247
BaeGI GKGCMC 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 247
BmgT120I GGNCC 1 cut(s) 247
BmiI GGNNCC 2 cut(s) 216, 249
BmrI ACTGGG 2 cut(s) 14, 245
BmuI ACTGGG 2 cut(s) 14, 245
BsaJI CCNNGG 4 cut(s) 368, 428, 512, 639
BsaWI WCCGGW 1 cut(s) 244
Bsc4I CCNNNNNNNGG 1 cut(s) 244
Bse118I RCCGGY 2 cut(s) 211, 244
Bse1I ACTGG 8 cut(s) 14, 20, 47, 80, 113, 146, 152, 251
BseDI CCNNGG 4 cut(s) 368, 428, 512, 639
BseGI GGATG 1 cut(s) 592
BseLI CCNNNNNNNGG 1 cut(s) 244
BseNI ACTGG 8 cut(s) 14, 20, 47, 80, 113, 146, 152, 251
BseSI GKGCMC 1 cut(s) 8
BshTI ACCGGT 1 cut(s) 244
BsiSI CCGG 2 cut(s) 212, 245
BslFI GGGAC 5 cut(s) 2, 35, 68, 101, 233
BslI CCNNNNNNNGG 1 cut(s) 244
BsmFI GGGAC 5 cut(s) 2, 35, 68, 101, 233
Bsp1286I GDGCHC 1 cut(s) 8
Bsp1407I TGTACA 4 cut(s) 24, 189, 222, 255
Bsp19I CCATGG 3 cut(s) 368, 428, 512
BspACI CCGC 4 cut(s) 200, 209, 233, 470
BspLI GGNNCC 2 cut(s) 216, 249
BsrBI CCGCTC 1 cut(s) 235
BsrFI RCCGGY 2 cut(s) 211, 244
BsrGI TGTACA 4 cut(s) 24, 189, 222, 255
BsrI ACTGG 8 cut(s) 14, 20, 47, 80, 113, 146, 152, 251
BssAI RCCGGY 2 cut(s) 211, 244
BssECI CCNNGG 4 cut(s) 368, 428, 512, 639
BssNAI GTATAC 2 cut(s) 58, 91
BssT1I CCWWGG 4 cut(s) 368, 428, 512, 639
Bst1107I GTATAC 2 cut(s) 58, 91
BstAUI TGTACA 4 cut(s) 24, 189, 222, 255
BstDSI CCRYGG 3 cut(s) 368, 428, 512
BstF5I GGATG 1 cut(s) 592
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstSLI GKGCMC 1 cut(s) 8
BstXI CCANNNNNNTGG 3 cut(s) 369, 429, 513
BstZ17I GTATAC 2 cut(s) 58, 91
BtgI CCRYGG 3 cut(s) 368, 428, 512
BtsCI GGATG 1 cut(s) 592
BtsIMutI CAGTG 2 cut(s) 27, 258
CaiI CAGNNNCTG 3 cut(s) 53, 86, 119
Cfr10I RCCGGY 2 cut(s) 211, 244
Cfr13I GGNCC 1 cut(s) 247
Csp6I GTAC 4 cut(s) 25, 190, 223, 256
CspAI ACCGGT 1 cut(s) 244
CviAII CATG 3 cut(s) 369, 429, 513
CviQI GTAC 4 cut(s) 25, 190, 223, 256
Eco130I CCWWGG 4 cut(s) 368, 428, 512, 639
Eco47I GGWCC 1 cut(s) 247
EcoT14I CCWWGG 4 cut(s) 368, 428, 512, 639
ErhI CCWWGG 4 cut(s) 368, 428, 512, 639
FaeI CATG 3 cut(s) 372, 432, 516
FaiI YATR 6 cut(s) 58, 91, 126, 370, 430, 514
FaqI GGGAC 5 cut(s) 2, 35, 68, 101, 233
FatI CATG 3 cut(s) 368, 428, 512
FblI GTMKAC 2 cut(s) 57, 90
FokI GGATG 1 cut(s) 579
HapII CCGG 2 cut(s) 212, 245
Hin1II CATG 3 cut(s) 372, 432, 516
HinfI GANTC 1 cut(s) 583
HpaII CCGG 2 cut(s) 212, 245
Hpy188III TCNNGA 1 cut(s) 556
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
Hsp92II CATG 3 cut(s) 372, 432, 516
LmnI GCTCC 1 cut(s) 240
MbiI CCGCTC 1 cut(s) 235
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 2 cut(s) 339, 399
MseI TTAA 2 cut(s) 603, 646
MslI CAYNNNNRTG 3 cut(s) 367, 427, 511
MspI CCGG 2 cut(s) 212, 245
MwoI GCNNNNNNNGC 1 cut(s) 208
NcoI CCATGG 3 cut(s) 368, 428, 512
NlaIII CATG 3 cut(s) 372, 432, 516
NlaIV GGNNCC 2 cut(s) 216, 249
PfeI GAWTC 1 cut(s) 583
PinAI ACCGGT 1 cut(s) 244
PspN4I GGNNCC 2 cut(s) 216, 249
PspPI GGNCC 1 cut(s) 247
PstNI CAGNNNCTG 3 cut(s) 53, 86, 119
RsaI GTAC 4 cut(s) 26, 191, 224, 257
RsaNI GTAC 4 cut(s) 25, 190, 223, 256
RseI CAYNNNNRTG 3 cut(s) 367, 427, 511
SaqAI TTAA 2 cut(s) 603, 646
Sau96I GGNCC 1 cut(s) 247
SduI GDGCHC 1 cut(s) 8
SetI ASST 7 cut(s) 181, 277, 337, 397, 481, 571, 645
SinI GGWCC 1 cut(s) 247
SmiMI CAYNNNNRTG 3 cut(s) 367, 427, 511
Sse9I AATT 2 cut(s) 339, 399
SsiI CCGC 4 cut(s) 200, 209, 233, 470
StyI CCWWGG 4 cut(s) 368, 428, 512, 639
TasI AATT 2 cut(s) 339, 399
TatI WGTACW 4 cut(s) 24, 189, 222, 255
TfiI GAWTC 1 cut(s) 583
Tru1I TTAA 2 cut(s) 603, 646
Tru9I TTAA 2 cut(s) 603, 646
TscAI CASTG 2 cut(s) 27, 258
TspRI CASTG 2 cut(s) 27, 258
VpaK11BI GGWCC 1 cut(s) 247
XmiI GTMKAC 2 cut(s) 57, 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.