Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001548.1

Orthogroup ID

OG0013749

Physical Location & Seq

Genomic Coordinates Forward (+)

56373 .. 58379

Gene Structure 2007 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001548.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 687 bp

atgcagaacaaagattggggttggggactgcatatagaagggccaagtacaaggttttgtacagctttgtcctatgtgagtttgagattgctcggagaggagttggatggcggtgatggcggcatggagaaggcaagaaaatggattcttcaccgtggaggagttgccaccatcccatcatggggaaagatgtggctctcactgcgtctcagtgctagctctggtctttggctgcgccggcgcttgatggatgtggccggaccagatagttgtttaactgtattcatatctcgaaaactggggttggagagggttttaatggtgttgggtccctgccggatcgtagtgatgtctcacggtggtcggaggacgtggtggactcagtggatagagggatcggattgctgggtcgacggaatggtgagagaaagcggagtggaggctgattttcgccggttcggagtgtggatgcatggctgtgggctgggagcaataattcattttcagatcggtggatcgtgctggctggattgtcagattggactttcgatctggtttctggccacacgggcttggggttgggatgagatttgggaactttcgctggtgtcccgtcggcgacagggtggtgagggtccgacgtcgggactcatgcgacggcatggcgtggtgcagctgctaacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000250 GO:0003674 GO:0003824 GO:0016853 GO:0016866 GO:0031559

KEGG Pathways

Metabolic & Signaling

ko00100 ko01100 ko01110 ko01130 map00100 map01100 map01110 map01130

Pfam Domains

Protein Families

SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

228

Amino Acids

25.69

Weight (kDa)

9.18

Isoelectric Point (pI)

57.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013749)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0318001 RchiOBHm_Chr1g0324841 RchiOBHm_Chr5g0021671
rosa_laevigata	RLG00000007139
rosa_multiflora	Rmu_sc0001468.1_g000013 Rmu_sc0001548.1_g000011 Rmu_sc0001898.1_g000019 Rmu_sc0003929.1_g000003 Rmu_sc0006323.1_g000030
rosa_roxburghii	Rroxscaffold_2G00124030
rosa_samantha	Rh1DG093700 Rh2AG457300 Rh2CG292400 Rh2CG444700 Rh2DG368600 Rh6BG237600 Rh6CG189500
rosa_wichuraiana	Rw0G020430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	644
AccI	GTMKAC	1 cut(s)	411
AciI	CCGC	3 cut(s)	111, 120, 432
AclWI	GGATC	3 cut(s)	347, 403, 523
AcoI	YGGCCR	2 cut(s)	255, 561
AcyI	GRCGYC	1 cut(s)	641
AfaI	GTAC	2 cut(s)	49, 61
AfiI	CCNNNNNNNGG	3 cut(s)	181, 182, 644
AjiI	CACGTC	1 cut(s)	372
AluBI	AGCT	3 cut(s)	65, 219, 676
AluI	AGCT	3 cut(s)	65, 219, 676
Alw26I	GTCTC	2 cut(s)	212, 357
AlwI	GGATC	3 cut(s)	347, 403, 523
AoxI	GGCC	3 cut(s)	41, 255, 561
ApeKI	GCWGC	3 cut(s)	232, 673, 676
AspLEI	GCGC	2 cut(s)	237, 243
AspS9I	GGNCC	4 cut(s)	41, 260, 329, 635
AsuHPI	GGTGA	4 cut(s)	125, 143, 433, 641
AsuNHI	GCTAGC	1 cut(s)	215
AvaII	GGWCC	3 cut(s)	260, 329, 635
BalI	TGGCCA	1 cut(s)	563
BbvI	GCAGC	2 cut(s)	219, 663
BccI	CCATC	5 cut(s)	101, 110, 179, 184, 241
BceAI	ACGGC	1 cut(s)	674
BcoDI	GTCTC	2 cut(s)	212, 357
BfaI	CTAG	1 cut(s)	216
BfoI	RGCGCY	1 cut(s)	244
BglI	GCCNNNNNGGC	1 cut(s)	569
BisI	GCNGC	4 cut(s)	121, 233, 674, 677
BlsI	GCNGC	4 cut(s)	122, 234, 675, 678
Bme18I	GGWCC	3 cut(s)	260, 329, 635
BmgBI	CACGTC	1 cut(s)	372
BmgT120I	GGNCC	4 cut(s)	41, 260, 329, 635
BmiI	GGNNCC	3 cut(s)	330, 331, 636
BmrI	ACTGGG	1 cut(s)	308
BmsI	GCATC	1 cut(s)	459
BmtI	GCTAGC	1 cut(s)	219
BmuI	ACTGGG	1 cut(s)	308
BsaHI	GRCGYC	1 cut(s)	641
BsaJI	CCNNGG	1 cut(s)	154
Bsc4I	CCNNNNNNNGG	3 cut(s)	181, 182, 644
Bse118I	RCCGGY	2 cut(s)	237, 453
Bse1I	ACTGG	1 cut(s)	303
BseDI	CCNNGG	1 cut(s)	154
BseGI	GGATG	5 cut(s)	112, 171, 256, 474, 589
BseLI	CCNNNNNNNGG	3 cut(s)	181, 182, 644
BseMII	CTCAG	2 cut(s)	223, 395
BseNI	ACTGG	1 cut(s)	303
BseRI	GAGGAG	2 cut(s)	113, 174
BseXI	GCAGC	2 cut(s)	219, 663
BseYI	CCCAGC	2 cut(s)	405, 484
BshFI	GGCC	3 cut(s)	43, 257, 563
BsiSI	CCGG	4 cut(s)	238, 258, 337, 454
BslFI	GGGAC	4 cut(s)	39, 315, 595, 660
BslI	CCNNNNNNNGG	3 cut(s)	181, 182, 644
BsmAI	GTCTC	2 cut(s)	212, 357
BsmBI	CGTCTC	1 cut(s)	212
BsmFI	GGGAC	4 cut(s)	39, 315, 595, 660
BsnI	GGCC	3 cut(s)	43, 257, 563
Bsp1407I	TGTACA	1 cut(s)	59
Bsp143I	GATC	5 cut(s)	339, 395, 507, 515, 549
BspACI	CCGC	3 cut(s)	111, 120, 432
BspANI	GGCC	3 cut(s)	43, 257, 563
BspCNI	CTCAG	2 cut(s)	222, 394
BspLI	GGNNCC	3 cut(s)	330, 331, 636
BspOI	GCTAGC	1 cut(s)	219
BspPI	GGATC	3 cut(s)	347, 403, 523
BsrFI	RCCGGY	2 cut(s)	237, 453
BsrGI	TGTACA	1 cut(s)	59
BsrI	ACTGG	1 cut(s)	303
BssAI	RCCGGY	2 cut(s)	237, 453
BssECI	CCNNGG	1 cut(s)	154
BssMI	GATC	5 cut(s)	339, 395, 507, 515, 549
BssNI	GRCGYC	1 cut(s)	641
Bst4CI	ACNGT	3 cut(s)	155, 280, 359
BstACI	GRCGYC	1 cut(s)	641
BstAUI	TGTACA	1 cut(s)	59
BstC8I	GCNNGC	3 cut(s)	217, 239, 524
BstDEI	CTNAG	2 cut(s)	209, 381
BstDSI	CCRYGG	1 cut(s)	154
BstF5I	GGATG	5 cut(s)	112, 171, 256, 474, 589
BstH2I	RGCGCY	1 cut(s)	244
BstHHI	GCGC	2 cut(s)	237, 243
BstKTI	GATC	5 cut(s)	342, 398, 510, 518, 552
BstMAI	GTCTC	2 cut(s)	212, 357
BstMBI	GATC	5 cut(s)	339, 395, 507, 515, 549
BstMWI	GCNNNNNNNGC	4 cut(s)	117, 202, 238, 569
BstV1I	GCAGC	2 cut(s)	219, 663
BsuRI	GGCC	3 cut(s)	43, 257, 563
BtgI	CCRYGG	1 cut(s)	154
BtrI	CACGTC	1 cut(s)	372
BtsCI	GGATG	5 cut(s)	112, 171, 256, 474, 589
BtsI	GCAGTG	1 cut(s)	200
BtsIMutI	CAGTG	3 cut(s)	200, 217, 389
Cac8I	GCNNGC	3 cut(s)	217, 239, 524
CfoI	GCGC	2 cut(s)	237, 243
Cfr10I	RCCGGY	2 cut(s)	237, 453
Cfr13I	GGNCC	4 cut(s)	41, 260, 329, 635
CseI	GACGC	1 cut(s)	194
Csp6I	GTAC	2 cut(s)	48, 60
CviAII	CATG	5 cut(s)	124, 180, 473, 652, 662
CviQI	GTAC	2 cut(s)	48, 60
DdeI	CTNAG	2 cut(s)	209, 381
DpnI	GATC	5 cut(s)	341, 397, 509, 517, 551
DpnII	GATC	5 cut(s)	339, 395, 507, 515, 549
EaeI	YGGCCR	2 cut(s)	255, 561
Eco47I	GGWCC	3 cut(s)	260, 329, 635
EcoO109I	RGGNCCY	1 cut(s)	329
EcoT22I	ATGCAT	1 cut(s)	474
Esp3I	CGTCTC	1 cut(s)	212
FaeI	CATG	5 cut(s)	127, 183, 476, 655, 665
FaqI	GGGAC	4 cut(s)	39, 315, 595, 660
FatI	CATG	5 cut(s)	123, 179, 472, 651, 661
FblI	GTMKAC	1 cut(s)	411
Fnu4HI	GCNGC	4 cut(s)	121, 233, 674, 677
FokI	GGATG	5 cut(s)	119, 158, 263, 481, 596
Fsp4HI	GCNGC	4 cut(s)	121, 233, 674, 677
FspBI	CTAG	1 cut(s)	216
GlaI	GCGC	2 cut(s)	236, 242
GluI	GCNGC	4 cut(s)	121, 233, 674, 677
GsaI	CCCAGC	2 cut(s)	409, 488
HaeII	RGCGCY	1 cut(s)	244
HaeIII	GGCC	3 cut(s)	43, 257, 563
HapII	CCGG	4 cut(s)	238, 258, 337, 454
HgaI	GACGC	1 cut(s)	194
HhaI	GCGC	2 cut(s)	237, 243
Hin1I	GRCGYC	1 cut(s)	641
Hin1II	CATG	5 cut(s)	127, 183, 476, 655, 665
Hin6I	GCGC	2 cut(s)	235, 241
HinP1I	GCGC	2 cut(s)	235, 241
HincII	GTYRAC	1 cut(s)	412
HindII	GTYRAC	1 cut(s)	412
HinfI	GANTC	3 cut(s)	145, 379, 648
HpaII	CCGG	4 cut(s)	238, 258, 337, 454
HphI	GGTGA	4 cut(s)	125, 143, 433, 641
Hpy166II	GTNNAC	2 cut(s)	378, 412
Hpy188I	TCNGA	7 cut(s)	95, 366, 400, 461, 507, 537, 639
Hpy188III	TCNNGA	2 cut(s)	291, 645
Hpy8I	GTNNAC	2 cut(s)	378, 412
Hpy99I	CGWCG	5 cut(s)	416, 618, 643, 646, 660
HpyAV	CCTTC	2 cut(s)	32, 124
HpyCH4III	ACNGT	3 cut(s)	155, 280, 359
HpyCH4IV	ACGT	2 cut(s)	371, 641
HpyCH4V	TGCA	4 cut(s)	4, 31, 472, 673
HpyF10VI	GCNNNNNNNGC	4 cut(s)	117, 202, 238, 569
HpyF3I	CTNAG	2 cut(s)	209, 381
HpySE526I	ACGT	2 cut(s)	371, 641
Hsp92I	GRCGYC	1 cut(s)	641
Hsp92II	CATG	5 cut(s)	127, 183, 476, 655, 665
HspAI	GCGC	2 cut(s)	235, 241
KflI	GGGWCCC	1 cut(s)	329
KroI	GCCGGC	1 cut(s)	237
KroNI	GCCGGC	1 cut(s)	239
Kzo9I	GATC	5 cut(s)	339, 395, 507, 515, 549
LmnI	GCTCC	1 cut(s)	488
Lsp1109I	GCAGC	2 cut(s)	219, 663
LweI	GCATC	1 cut(s)	459
MaeI	CTAG	1 cut(s)	216
MaeII	ACGT	2 cut(s)	371, 641
MalI	GATC	5 cut(s)	341, 397, 509, 517, 551
MboI	GATC	5 cut(s)	339, 395, 507, 515, 549
MboII	GAAGA	1 cut(s)	140
MlsI	TGGCCA	1 cut(s)	563
MluCI	AATT	1 cut(s)	495
MluNI	TGGCCA	1 cut(s)	563
MlyI	GAGTC	2 cut(s)	373, 642
MmeI	TCCRAC	4 cut(s)	84, 285, 344, 662
MnlI	CCTC	7 cut(s)	91, 152, 303, 360, 385, 433, 625
Mox20I	TGGCCA	1 cut(s)	563
Mph1103I	ATGCAT	1 cut(s)	474
MreI	CGCCGGCG	1 cut(s)	237
MroNI	GCCGGC	1 cut(s)	237
MscI	TGGCCA	1 cut(s)	563
MseI	TTAA	2 cut(s)	275, 317
MslI	CAYNNNNRTG	1 cut(s)	477
Msp20I	TGGCCA	1 cut(s)	563
MspA1I	CMGCKG	1 cut(s)	676
MspI	CCGG	4 cut(s)	238, 258, 337, 454
MwoI	GCNNNNNNNGC	4 cut(s)	117, 202, 238, 569
NaeI	GCCGGC	1 cut(s)	239
NdeII	GATC	5 cut(s)	339, 395, 507, 515, 549
NgoMIV	GCCGGC	1 cut(s)	237
NheI	GCTAGC	1 cut(s)	215
NlaIII	CATG	5 cut(s)	127, 183, 476, 655, 665
NlaIV	GGNNCC	3 cut(s)	330, 331, 636
NsiI	ATGCAT	1 cut(s)	474
PdiI	GCCGGC	1 cut(s)	239
PfeI	GAWTC	1 cut(s)	145
PkrI	GCNGC	4 cut(s)	122, 234, 675, 678
PleI	GAGTC	2 cut(s)	373, 642
PpsI	GAGTC	2 cut(s)	373, 642
PpuMI	RGGWCCY	1 cut(s)	329
Psp5II	RGGWCCY	1 cut(s)	329
PspFI	CCCAGC	2 cut(s)	405, 484
PspN4I	GGNNCC	3 cut(s)	330, 331, 636
PspPI	GGNCC	4 cut(s)	41, 260, 329, 635
PspPPI	RGGWCCY	1 cut(s)	329
PvuII	CAGCTG	1 cut(s)	676
RsaI	GTAC	2 cut(s)	49, 61
RsaNI	GTAC	2 cut(s)	48, 60
RseI	CAYNNNNRTG	1 cut(s)	477
SalI	GTCGAC	1 cut(s)	410
SaqAI	TTAA	2 cut(s)	275, 317
SatI	GCNGC	4 cut(s)	121, 233, 674, 677
Sau3AI	GATC	5 cut(s)	339, 395, 507, 515, 549
Sau96I	GGNCC	4 cut(s)	41, 260, 329, 635
SchI	GAGTC	2 cut(s)	373, 642
SetI	ASST	6 cut(s)	56, 67, 221, 374, 644, 678
SfaNI	GCATC	1 cut(s)	459
SgrAI	CRCCGGYG	1 cut(s)	237
SinI	GGWCC	3 cut(s)	260, 329, 635
SmiMI	CAYNNNNRTG	1 cut(s)	477
Sse9I	AATT	1 cut(s)	495
SsiI	CCGC	3 cut(s)	111, 120, 432
SspMI	CTAG	1 cut(s)	216
TaaI	ACNGT	3 cut(s)	155, 280, 359
TaiI	ACGT	2 cut(s)	374, 644
TaqI	TCGA	3 cut(s)	292, 411, 548
TasI	AATT	1 cut(s)	495
TatI	WGTACW	2 cut(s)	47, 59
TauI	GCSGC	1 cut(s)	123
TfiI	GAWTC	1 cut(s)	145
Tru1I	TTAA	2 cut(s)	275, 317
Tru9I	TTAA	2 cut(s)	275, 317
TscAI	CASTG	3 cut(s)	207, 217, 389
TseI	GCWGC	3 cut(s)	232, 673, 676
TspDTI	ATGAA	2 cut(s)	274, 488
TspGWI	ACGGA	1 cut(s)	429
TspRI	CASTG	3 cut(s)	207, 217, 389
VpaK11BI	GGWCC	3 cut(s)	260, 329, 635
XmiI	GTMKAC	1 cut(s)	411
XspI	CTAG	1 cut(s)	216
ZraI	GACGTC	1 cut(s)	642
Zsp2I	ATGCAT	1 cut(s)	474

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.