Rh2CG292400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0013749
Physical Location & Seq
Forward (+)
33125307 .. 33125612
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG292400.1

Sequence Viewer

Length: 306 bp
ATGGGGTGTGGGATCCTTCGCTGTTGGTCCATCAGCGGCGGGATGGCGTTGGTGGTGAGGGTCCGACCTTGGGGGAACTGCGGCGGCGGTGGCTGTGGCGTGGTGCAGCTGCTAGCTTGGACCGGCGGTAGCTTAGGTTTCTTAGAACGTCAAGAACATCGAGAAAGGTCCTTACTTTCCCATGTTCCTCTATTCAATTTCTGCTTAATTCATTATCATTTGTTATATATTGCTTATACCATCGTTTTTTCTTGTAAATTTATATTGAAAATGGACTATAATGTCAGTAAAAGACCCATTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.31

Weight (kDa)

9.27

Isoelectric Point (pI)

47.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 281
AciI CCGC 6 cut(s) 36, 39, 81, 84, 87, 126
AclWI GGATC 2 cut(s) 7, 20
AcsI RAATTY 1 cut(s) 257
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 2 cut(s) 196, 268
AluBI AGCT 3 cut(s) 109, 116, 132
AluI AGCT 3 cut(s) 109, 116, 132
AlwI GGATC 2 cut(s) 7, 20
ApeKI GCWGC 2 cut(s) 106, 109
ApoI RAATTY 1 cut(s) 257
AspS9I GGNCC 4 cut(s) 27, 61, 120, 168
AsuHPI GGTGA 1 cut(s) 67
AsuNHI GCTAGC 1 cut(s) 112
AvaII GGWCC 4 cut(s) 27, 61, 120, 168
BamHI GGATCC 1 cut(s) 12
BbvI GCAGC 2 cut(s) 96, 118
BccI CCATC 3 cut(s) 37, 38, 248
BfaI CTAG 1 cut(s) 113
BisI GCNGC 5 cut(s) 37, 82, 85, 107, 110
BlsI GCNGC 5 cut(s) 38, 83, 86, 108, 111
Bme18I GGWCC 4 cut(s) 27, 61, 120, 168
BmgT120I GGNCC 4 cut(s) 27, 61, 120, 168
BmiI GGNNCC 2 cut(s) 14, 62
BmtI GCTAGC 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse118I RCCGGY 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 68
BseGI GGATG 1 cut(s) 48
BseLI CCNNNNNNNGG 1 cut(s) 70
BseXI GCAGC 2 cut(s) 96, 118
BsgI GTGCAG 1 cut(s) 125
BsiSI CCGG 1 cut(s) 123
BslI CCNNNNNNNGG 1 cut(s) 70
Bsp143I GATC 1 cut(s) 12
BspACI CCGC 6 cut(s) 36, 39, 81, 84, 87, 126
BspLI GGNNCC 2 cut(s) 14, 62
BspOI GCTAGC 1 cut(s) 116
BspPI GGATC 2 cut(s) 7, 20
BsrFI RCCGGY 1 cut(s) 122
BssAI RCCGGY 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 68
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 2 cut(s) 133, 142
BstF5I GGATG 1 cut(s) 48
BstKTI GATC 1 cut(s) 15
BstMBI GATC 1 cut(s) 12
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstV1I GCAGC 2 cut(s) 96, 118
BstX2I RGATCY 1 cut(s) 12
BstYI RGATCY 1 cut(s) 12
BtsCI GGATG 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 114
Cfr10I RCCGGY 1 cut(s) 122
Cfr13I GGNCC 4 cut(s) 27, 61, 120, 168
CviAII CATG 1 cut(s) 182
CviJI RGCY 4 cut(s) 93, 109, 116, 132
CviKI_1 RGCY 4 cut(s) 93, 109, 116, 132
DdeI CTNAG 2 cut(s) 133, 142
DpnI GATC 1 cut(s) 14
DpnII GATC 1 cut(s) 12
DrdI GACNNNNNNGTC 1 cut(s) 281
DseDI GACNNNNNNGTC 1 cut(s) 281
Eco130I CCWWGG 1 cut(s) 68
Eco47I GGWCC 4 cut(s) 27, 61, 120, 168
EcoO109I RGGNCCY 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 68
ErhI CCWWGG 1 cut(s) 68
FaeI CATG 1 cut(s) 185
FaiI YATR 7 cut(s) 183, 226, 228, 237, 263, 279, 304
FatI CATG 1 cut(s) 181
FauI CCCGC 1 cut(s) 32
Fnu4HI GCNGC 5 cut(s) 37, 82, 85, 107, 110
FokI GGATG 1 cut(s) 55
Fsp4HI GCNGC 5 cut(s) 37, 82, 85, 107, 110
FspBI CTAG 1 cut(s) 113
GluI GCNGC 5 cut(s) 37, 82, 85, 107, 110
HapII CCGG 1 cut(s) 123
Hin1II CATG 1 cut(s) 185
HpaII CCGG 1 cut(s) 123
HphI GGTGA 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 65
Hpy188III TCNNGA 2 cut(s) 152, 161
HpyAV CCTTC 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
HpyF3I CTNAG 2 cut(s) 133, 142
HpySE526I ACGT 1 cut(s) 148
Hsp92II CATG 1 cut(s) 185
Kzo9I GATC 1 cut(s) 12
LpnPI CCDG 1 cut(s) 136
Lsp1109I GCAGC 2 cut(s) 96, 118
MaeI CTAG 1 cut(s) 113
MaeII ACGT 1 cut(s) 148
MalI GATC 1 cut(s) 14
MboI GATC 1 cut(s) 12
MflI RGATCY 1 cut(s) 12
MluCI AATT 3 cut(s) 196, 207, 257
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 2 cut(s) 51, 198
MseI TTAA 1 cut(s) 206
MspA1I CMGCKG 2 cut(s) 36, 109
MspI CCGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 90
NdeII GATC 1 cut(s) 12
NheI GCTAGC 1 cut(s) 112
NlaIII CATG 1 cut(s) 185
NlaIV GGNNCC 2 cut(s) 14, 62
PkrI GCNGC 5 cut(s) 38, 83, 86, 108, 111
PpuMI RGGWCCY 1 cut(s) 168
Psp5II RGGWCCY 1 cut(s) 168
PspN4I GGNNCC 2 cut(s) 14, 62
PspPI GGNCC 4 cut(s) 27, 61, 120, 168
PspPPI RGGWCCY 1 cut(s) 168
PsuI RGATCY 1 cut(s) 12
PvuII CAGCTG 1 cut(s) 109
SaqAI TTAA 1 cut(s) 206
SatI GCNGC 5 cut(s) 37, 82, 85, 107, 110
Sau3AI GATC 1 cut(s) 12
Sau96I GGNCC 4 cut(s) 27, 61, 120, 168
SetI ASST 7 cut(s) 70, 111, 118, 134, 139, 151, 170
SinI GGWCC 4 cut(s) 27, 61, 120, 168
Sse9I AATT 3 cut(s) 196, 207, 257
SsiI CCGC 6 cut(s) 36, 39, 81, 84, 87, 126
SspMI CTAG 1 cut(s) 113
StyI CCWWGG 1 cut(s) 68
TaiI ACGT 1 cut(s) 151
TaqI TCGA 1 cut(s) 160
TasI AATT 3 cut(s) 196, 207, 257
TauI GCSGC 3 cut(s) 39, 84, 87
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TseI GCWGC 2 cut(s) 106, 109
TspDTI ATGAA 2 cut(s) 200, 291
VpaK11BI GGWCC 4 cut(s) 27, 61, 120, 168
XapI RAATTY 1 cut(s) 257
XspI CTAG 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.