Rmu_sc0001548.1_g000011

Belongs to the terpene cyclase mutase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001548.1
OG0013749
Physical Location & Seq
Forward (+)
56373 .. 58379
2007 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 687 bp
atgcagaacaaagattggggttggggactgcatatagaagggccaagtacaaggttttgtacagctttgtcctatgtgagtttgagattgctcggagaggagttggatggcggtgatggcggcatggagaaggcaagaaaatggattcttcaccgtggaggagttgccaccatcccatcatggggaaagatgtggctctcactgcgtctcagtgctagctctggtctttggctgcgccggcgcttgatggatgtggccggaccagatagttgtttaactgtattcatatctcgaaaactggggttggagagggttttaatggtgttgggtccctgccggatcgtagtgatgtctcacggtggtcggaggacgtggtggactcagtggatagagggatcggattgctgggtcgacggaatggtgagagaaagcggagtggaggctgattttcgccggttcggagtgtggatgcatggctgtgggctgggagcaataattcattttcagatcggtggatcgtgctggctggattgtcagattggactttcgatctggtttctggccacacgggcttggggttgggatgagatttgggaactttcgctggtgtcccgtcggcgacagggtggtgagggtccgacgtcgggactcatgcgacggcatggcgtggtgcagctgctaacatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000250 GO:0003674 GO:0003824 GO:0016853 GO:0016866 GO:0031559
KEGG Pathways
Metabolic & Signaling
ko00100 ko01100 ko01110 ko01130 map00100 map01100 map01110 map01130
Pfam Domains
Protein Families
SQHop_cyclase_C SQHop_cyclase_N

Protein Analysis

228

Amino Acids

25.69

Weight (kDa)

9.18

Isoelectric Point (pI)

57.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SQHop_cyclase_N PF13249 2 - 68 4.7e-12 Squalene-hopene cyclase N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 644
AccI GTMKAC 1 cut(s) 411
AciI CCGC 3 cut(s) 111, 120, 432
AclWI GGATC 3 cut(s) 347, 403, 523
AcoI YGGCCR 2 cut(s) 255, 561
AcyI GRCGYC 1 cut(s) 641
AfaI GTAC 2 cut(s) 49, 61
AfiI CCNNNNNNNGG 3 cut(s) 181, 182, 644
AjiI CACGTC 1 cut(s) 372
AluBI AGCT 3 cut(s) 65, 219, 676
AluI AGCT 3 cut(s) 65, 219, 676
Alw26I GTCTC 2 cut(s) 212, 357
AlwI GGATC 3 cut(s) 347, 403, 523
AoxI GGCC 3 cut(s) 41, 255, 561
ApeKI GCWGC 3 cut(s) 232, 673, 676
AspLEI GCGC 2 cut(s) 237, 243
AspS9I GGNCC 4 cut(s) 41, 260, 329, 635
AsuHPI GGTGA 4 cut(s) 125, 143, 433, 641
AsuNHI GCTAGC 1 cut(s) 215
AvaII GGWCC 3 cut(s) 260, 329, 635
BalI TGGCCA 1 cut(s) 563
BbvI GCAGC 2 cut(s) 219, 663
BccI CCATC 5 cut(s) 101, 110, 179, 184, 241
BceAI ACGGC 1 cut(s) 674
BcoDI GTCTC 2 cut(s) 212, 357
BfaI CTAG 1 cut(s) 216
BfoI RGCGCY 1 cut(s) 244
BglI GCCNNNNNGGC 1 cut(s) 569
BisI GCNGC 4 cut(s) 121, 233, 674, 677
BlsI GCNGC 4 cut(s) 122, 234, 675, 678
Bme18I GGWCC 3 cut(s) 260, 329, 635
BmgBI CACGTC 1 cut(s) 372
BmgT120I GGNCC 4 cut(s) 41, 260, 329, 635
BmiI GGNNCC 3 cut(s) 330, 331, 636
BmrI ACTGGG 1 cut(s) 308
BmsI GCATC 1 cut(s) 459
BmtI GCTAGC 1 cut(s) 219
BmuI ACTGGG 1 cut(s) 308
BsaHI GRCGYC 1 cut(s) 641
BsaJI CCNNGG 1 cut(s) 154
Bsc4I CCNNNNNNNGG 3 cut(s) 181, 182, 644
Bse118I RCCGGY 2 cut(s) 237, 453
Bse1I ACTGG 1 cut(s) 303
BseDI CCNNGG 1 cut(s) 154
BseGI GGATG 5 cut(s) 112, 171, 256, 474, 589
BseLI CCNNNNNNNGG 3 cut(s) 181, 182, 644
BseMII CTCAG 2 cut(s) 223, 395
BseNI ACTGG 1 cut(s) 303
BseRI GAGGAG 2 cut(s) 113, 174
BseXI GCAGC 2 cut(s) 219, 663
BseYI CCCAGC 2 cut(s) 405, 484
BshFI GGCC 3 cut(s) 43, 257, 563
BsiSI CCGG 4 cut(s) 238, 258, 337, 454
BslFI GGGAC 4 cut(s) 39, 315, 595, 660
BslI CCNNNNNNNGG 3 cut(s) 181, 182, 644
BsmAI GTCTC 2 cut(s) 212, 357
BsmBI CGTCTC 1 cut(s) 212
BsmFI GGGAC 4 cut(s) 39, 315, 595, 660
BsnI GGCC 3 cut(s) 43, 257, 563
Bsp1407I TGTACA 1 cut(s) 59
Bsp143I GATC 5 cut(s) 339, 395, 507, 515, 549
BspACI CCGC 3 cut(s) 111, 120, 432
BspANI GGCC 3 cut(s) 43, 257, 563
BspCNI CTCAG 2 cut(s) 222, 394
BspLI GGNNCC 3 cut(s) 330, 331, 636
BspOI GCTAGC 1 cut(s) 219
BspPI GGATC 3 cut(s) 347, 403, 523
BsrFI RCCGGY 2 cut(s) 237, 453
BsrGI TGTACA 1 cut(s) 59
BsrI ACTGG 1 cut(s) 303
BssAI RCCGGY 2 cut(s) 237, 453
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 5 cut(s) 339, 395, 507, 515, 549
BssNI GRCGYC 1 cut(s) 641
Bst4CI ACNGT 3 cut(s) 155, 280, 359
BstACI GRCGYC 1 cut(s) 641
BstAUI TGTACA 1 cut(s) 59
BstC8I GCNNGC 3 cut(s) 217, 239, 524
BstDEI CTNAG 2 cut(s) 209, 381
BstDSI CCRYGG 1 cut(s) 154
BstF5I GGATG 5 cut(s) 112, 171, 256, 474, 589
BstH2I RGCGCY 1 cut(s) 244
BstHHI GCGC 2 cut(s) 237, 243
BstKTI GATC 5 cut(s) 342, 398, 510, 518, 552
BstMAI GTCTC 2 cut(s) 212, 357
BstMBI GATC 5 cut(s) 339, 395, 507, 515, 549
BstMWI GCNNNNNNNGC 4 cut(s) 117, 202, 238, 569
BstV1I GCAGC 2 cut(s) 219, 663
BsuRI GGCC 3 cut(s) 43, 257, 563
BtgI CCRYGG 1 cut(s) 154
BtrI CACGTC 1 cut(s) 372
BtsCI GGATG 5 cut(s) 112, 171, 256, 474, 589
BtsI GCAGTG 1 cut(s) 200
BtsIMutI CAGTG 3 cut(s) 200, 217, 389
Cac8I GCNNGC 3 cut(s) 217, 239, 524
CfoI GCGC 2 cut(s) 237, 243
Cfr10I RCCGGY 2 cut(s) 237, 453
Cfr13I GGNCC 4 cut(s) 41, 260, 329, 635
CseI GACGC 1 cut(s) 194
Csp6I GTAC 2 cut(s) 48, 60
CviAII CATG 5 cut(s) 124, 180, 473, 652, 662
CviQI GTAC 2 cut(s) 48, 60
DdeI CTNAG 2 cut(s) 209, 381
DpnI GATC 5 cut(s) 341, 397, 509, 517, 551
DpnII GATC 5 cut(s) 339, 395, 507, 515, 549
EaeI YGGCCR 2 cut(s) 255, 561
Eco47I GGWCC 3 cut(s) 260, 329, 635
EcoO109I RGGNCCY 1 cut(s) 329
EcoT22I ATGCAT 1 cut(s) 474
Esp3I CGTCTC 1 cut(s) 212
FaeI CATG 5 cut(s) 127, 183, 476, 655, 665
FaqI GGGAC 4 cut(s) 39, 315, 595, 660
FatI CATG 5 cut(s) 123, 179, 472, 651, 661
FblI GTMKAC 1 cut(s) 411
Fnu4HI GCNGC 4 cut(s) 121, 233, 674, 677
FokI GGATG 5 cut(s) 119, 158, 263, 481, 596
Fsp4HI GCNGC 4 cut(s) 121, 233, 674, 677
FspBI CTAG 1 cut(s) 216
GlaI GCGC 2 cut(s) 236, 242
GluI GCNGC 4 cut(s) 121, 233, 674, 677
GsaI CCCAGC 2 cut(s) 409, 488
HaeII RGCGCY 1 cut(s) 244
HaeIII GGCC 3 cut(s) 43, 257, 563
HapII CCGG 4 cut(s) 238, 258, 337, 454
HgaI GACGC 1 cut(s) 194
HhaI GCGC 2 cut(s) 237, 243
Hin1I GRCGYC 1 cut(s) 641
Hin1II CATG 5 cut(s) 127, 183, 476, 655, 665
Hin6I GCGC 2 cut(s) 235, 241
HinP1I GCGC 2 cut(s) 235, 241
HincII GTYRAC 1 cut(s) 412
HindII GTYRAC 1 cut(s) 412
HinfI GANTC 3 cut(s) 145, 379, 648
HpaII CCGG 4 cut(s) 238, 258, 337, 454
HphI GGTGA 4 cut(s) 125, 143, 433, 641
Hpy166II GTNNAC 2 cut(s) 378, 412
Hpy188I TCNGA 7 cut(s) 95, 366, 400, 461, 507, 537, 639
Hpy188III TCNNGA 2 cut(s) 291, 645
Hpy8I GTNNAC 2 cut(s) 378, 412
Hpy99I CGWCG 5 cut(s) 416, 618, 643, 646, 660
HpyAV CCTTC 2 cut(s) 32, 124
HpyCH4III ACNGT 3 cut(s) 155, 280, 359
HpyCH4IV ACGT 2 cut(s) 371, 641
HpyCH4V TGCA 4 cut(s) 4, 31, 472, 673
HpyF10VI GCNNNNNNNGC 4 cut(s) 117, 202, 238, 569
HpyF3I CTNAG 2 cut(s) 209, 381
HpySE526I ACGT 2 cut(s) 371, 641
Hsp92I GRCGYC 1 cut(s) 641
Hsp92II CATG 5 cut(s) 127, 183, 476, 655, 665
HspAI GCGC 2 cut(s) 235, 241
KflI GGGWCCC 1 cut(s) 329
KroI GCCGGC 1 cut(s) 237
KroNI GCCGGC 1 cut(s) 239
Kzo9I GATC 5 cut(s) 339, 395, 507, 515, 549
LmnI GCTCC 1 cut(s) 488
Lsp1109I GCAGC 2 cut(s) 219, 663
LweI GCATC 1 cut(s) 459
MaeI CTAG 1 cut(s) 216
MaeII ACGT 2 cut(s) 371, 641
MalI GATC 5 cut(s) 341, 397, 509, 517, 551
MboI GATC 5 cut(s) 339, 395, 507, 515, 549
MboII GAAGA 1 cut(s) 140
MlsI TGGCCA 1 cut(s) 563
MluCI AATT 1 cut(s) 495
MluNI TGGCCA 1 cut(s) 563
MlyI GAGTC 2 cut(s) 373, 642
MmeI TCCRAC 4 cut(s) 84, 285, 344, 662
MnlI CCTC 7 cut(s) 91, 152, 303, 360, 385, 433, 625
Mox20I TGGCCA 1 cut(s) 563
Mph1103I ATGCAT 1 cut(s) 474
MreI CGCCGGCG 1 cut(s) 237
MroNI GCCGGC 1 cut(s) 237
MscI TGGCCA 1 cut(s) 563
MseI TTAA 2 cut(s) 275, 317
MslI CAYNNNNRTG 1 cut(s) 477
Msp20I TGGCCA 1 cut(s) 563
MspA1I CMGCKG 1 cut(s) 676
MspI CCGG 4 cut(s) 238, 258, 337, 454
MwoI GCNNNNNNNGC 4 cut(s) 117, 202, 238, 569
NaeI GCCGGC 1 cut(s) 239
NdeII GATC 5 cut(s) 339, 395, 507, 515, 549
NgoMIV GCCGGC 1 cut(s) 237
NheI GCTAGC 1 cut(s) 215
NlaIII CATG 5 cut(s) 127, 183, 476, 655, 665
NlaIV GGNNCC 3 cut(s) 330, 331, 636
NsiI ATGCAT 1 cut(s) 474
PdiI GCCGGC 1 cut(s) 239
PfeI GAWTC 1 cut(s) 145
PkrI GCNGC 4 cut(s) 122, 234, 675, 678
PleI GAGTC 2 cut(s) 373, 642
PpsI GAGTC 2 cut(s) 373, 642
PpuMI RGGWCCY 1 cut(s) 329
Psp5II RGGWCCY 1 cut(s) 329
PspFI CCCAGC 2 cut(s) 405, 484
PspN4I GGNNCC 3 cut(s) 330, 331, 636
PspPI GGNCC 4 cut(s) 41, 260, 329, 635
PspPPI RGGWCCY 1 cut(s) 329
PvuII CAGCTG 1 cut(s) 676
RsaI GTAC 2 cut(s) 49, 61
RsaNI GTAC 2 cut(s) 48, 60
RseI CAYNNNNRTG 1 cut(s) 477
SalI GTCGAC 1 cut(s) 410
SaqAI TTAA 2 cut(s) 275, 317
SatI GCNGC 4 cut(s) 121, 233, 674, 677
Sau3AI GATC 5 cut(s) 339, 395, 507, 515, 549
Sau96I GGNCC 4 cut(s) 41, 260, 329, 635
SchI GAGTC 2 cut(s) 373, 642
SetI ASST 6 cut(s) 56, 67, 221, 374, 644, 678
SfaNI GCATC 1 cut(s) 459
SgrAI CRCCGGYG 1 cut(s) 237
SinI GGWCC 3 cut(s) 260, 329, 635
SmiMI CAYNNNNRTG 1 cut(s) 477
Sse9I AATT 1 cut(s) 495
SsiI CCGC 3 cut(s) 111, 120, 432
SspMI CTAG 1 cut(s) 216
TaaI ACNGT 3 cut(s) 155, 280, 359
TaiI ACGT 2 cut(s) 374, 644
TaqI TCGA 3 cut(s) 292, 411, 548
TasI AATT 1 cut(s) 495
TatI WGTACW 2 cut(s) 47, 59
TauI GCSGC 1 cut(s) 123
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 275, 317
Tru9I TTAA 2 cut(s) 275, 317
TscAI CASTG 3 cut(s) 207, 217, 389
TseI GCWGC 3 cut(s) 232, 673, 676
TspDTI ATGAA 2 cut(s) 274, 488
TspGWI ACGGA 1 cut(s) 429
TspRI CASTG 3 cut(s) 207, 217, 389
VpaK11BI GGWCC 3 cut(s) 260, 329, 635
XmiI GTMKAC 1 cut(s) 411
XspI CTAG 1 cut(s) 216
ZraI GACGTC 1 cut(s) 642
Zsp2I ATGCAT 1 cut(s) 474
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.