Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001626.1

Orthogroup ID

OG0005368

Physical Location & Seq

Genomic Coordinates Forward (+)

58488 .. 58847

Gene Structure 360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001626.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 360 bp

atggtttttcaattgaagtctcttgaggaaagcctctcaacatttagtggacacatatcacggatctgtaatattttggaagtcgcctcaagagaatcacttgttctcattgatgaaattggtagcggaactgatccttcagaaggtgtggctctttctaccagcatcttgcaatatttcaaagatcgtgttaacttagctgttgtgactattcattacgcggatttaagtctcctaaaagaaaaggatcacctgtctgaaaatgcagccatggagttttctccagaaaccttacaaccaacttatcaggtccaatggggaagtattggtgactcaaaagcattgagtattgctatataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003677 GO:0003684 GO:0003690 GO:0003824 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006259 GO:0006281 GO:0006298 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008094 GO:0008150 GO:0008152 GO:0009987 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0030983 GO:0032300 GO:0032991 GO:0033554 GO:0034641 GO:0042623 GO:0043170 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0090304 GO:0097159 GO:1901360 GO:1901363 GO:1990391

KEGG Pathways

Metabolic & Signaling

ko03430 map03430

Pfam Domains

Protein Families

MutS_V Smr

Protein Analysis

119

Amino Acids

13.04

Weight (kDa)

4.65

Isoelectric Point (pI)

50.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005368)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G65070 AT1G65070 AT1G65070 AT1G65070
fragaria_vesca	FvH4_3g09390 FvH4_3g09390 FvH4_3g09390 FvH4_3g09390 FvH4_3g09390 FvH4_3g09390 FvH4_3g09390
malus_domestica	MD00G1095300.v1.1
prunus_persica	Prupe.4G045200_v2.0.a1
pyrus_communis	pycom10g24790
rosa_chinensis	RchiOBHm_Chr5g0008191
rosa_laevigata	RLG00000031545
rosa_multiflora	Rmu_co8487121.1_g000001 Rmu_sc0001352.1_g000007 Rmu_sc0001352.1_g000008 Rmu_sc0001352.1_g000029 Rmu_sc0001626.1_g000010
rosa_roxburghii	Rroxscaffold_1G00068290
rosa_rugosa	Rorug04G0434000 Rorug04G0434100
rosa_samantha	Rh5AG062400 Rh5BG058700 Rh5CG069200 Rh5DG058100
rosa_wichuraiana	Rw5G005850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	221
AciI	CCGC	2 cut(s)	126, 221
AclWI	GGATC	3 cut(s)	71, 128, 255
AcuI	CTGAAG	1 cut(s)	123
AfiI	CCNNNNNNNGG	1 cut(s)	143
AgsI	TTSAA	3 cut(s)	11, 16, 181
AluBI	AGCT	1 cut(s)	200
AluI	AGCT	1 cut(s)	200
Alw26I	GTCTC	2 cut(s)	24, 236
AlwI	GGATC	3 cut(s)	71, 128, 255
ApeKI	GCWGC	1 cut(s)	266
AspS9I	GGNCC	1 cut(s)	310
AsuHPI	GGTGA	2 cut(s)	242, 341
AvaII	GGWCC	1 cut(s)	310
BbvI	GCAGC	1 cut(s)	278
BcoDI	GTCTC	2 cut(s)	24, 236
BisI	GCNGC	1 cut(s)	267
BlsI	GCNGC	1 cut(s)	268
Bme18I	GGWCC	1 cut(s)	310
BmgT120I	GGNCC	1 cut(s)	310
BmsI	GCATC	1 cut(s)	174
BpmI	CTGGAG	1 cut(s)	267
BpuEI	CTTGAG	2 cut(s)	44, 73
BsaJI	CCNNGG	1 cut(s)	270
Bsc4I	CCNNNNNNNGG	1 cut(s)	143
BseDI	CCNNGG	1 cut(s)	270
BseLI	CCNNNNNNNGG	1 cut(s)	143
BseXI	GCAGC	1 cut(s)	278
Bsh1236I	CGCG	1 cut(s)	221
BslI	CCNNNNNNNGG	1 cut(s)	143
BsmAI	GTCTC	2 cut(s)	24, 236
Bsp143I	GATC	4 cut(s)	63, 133, 184, 247
Bsp19I	CCATGG	1 cut(s)	270
BspACI	CCGC	2 cut(s)	126, 221
BspFNI	CGCG	1 cut(s)	221
BspPI	GGATC	3 cut(s)	71, 128, 255
BssECI	CCNNGG	1 cut(s)	270
BssMI	GATC	4 cut(s)	63, 133, 184, 247
BssT1I	CCWWGG	1 cut(s)	270
BstDEI	CTNAG	1 cut(s)	196
BstDSI	CCRYGG	1 cut(s)	270
BstENI	CCTNNNNNAGG	1 cut(s)	141
BstFNI	CGCG	1 cut(s)	221
BstKTI	GATC	4 cut(s)	66, 136, 187, 250
BstMAI	GTCTC	2 cut(s)	24, 236
BstMBI	GATC	4 cut(s)	63, 133, 184, 247
BstUI	CGCG	1 cut(s)	221
BstV1I	GCAGC	1 cut(s)	278
BstX2I	RGATCY	1 cut(s)	63
BstYI	RGATCY	1 cut(s)	63
BtgI	CCRYGG	1 cut(s)	270
Cfr13I	GGNCC	1 cut(s)	310
CviAII	CATG	1 cut(s)	271
CviJI	RGCY	4 cut(s)	33, 152, 200, 269
CviKI_1	RGCY	4 cut(s)	33, 152, 200, 269
DdeI	CTNAG	1 cut(s)	196
DpnI	GATC	4 cut(s)	65, 135, 186, 249
DpnII	GATC	4 cut(s)	63, 133, 184, 247
Eco130I	CCWWGG	1 cut(s)	270
Eco47I	GGWCC	1 cut(s)	310
Eco57I	CTGAAG	1 cut(s)	123
EcoNI	CCTNNNNNAGG	1 cut(s)	141
EcoT14I	CCWWGG	1 cut(s)	270
ErhI	CCWWGG	1 cut(s)	270
FaeI	CATG	1 cut(s)	274
FaiI	YATR	4 cut(s)	56, 272, 356, 358
FatI	CATG	1 cut(s)	270
Fnu4HI	GCNGC	1 cut(s)	267
Fsp4HI	GCNGC	1 cut(s)	267
GluI	GCNGC	1 cut(s)	267
GsuI	CTGGAG	1 cut(s)	267
Hin1II	CATG	1 cut(s)	274
HincII	GTYRAC	1 cut(s)	193
HindII	GTYRAC	1 cut(s)	193
HinfI	GANTC	2 cut(s)	95, 332
HpaI	GTTAAC	1 cut(s)	193
HphI	GGTGA	2 cut(s)	242, 341
Hpy166II	GTNNAC	2 cut(s)	50, 193
Hpy188I	TCNGA	2 cut(s)	142, 259
Hpy188III	TCNNGA	3 cut(s)	23, 90, 284
Hpy8I	GTNNAC	2 cut(s)	50, 193
HpyAV	CCTTC	2 cut(s)	137, 147
HpyCH4V	TGCA	2 cut(s)	172, 266
HpyF3I	CTNAG	1 cut(s)	196
Hsp92II	CATG	1 cut(s)	274
KspAI	GTTAAC	1 cut(s)	193
Kzo9I	GATC	4 cut(s)	63, 133, 184, 247
LpnPI	CCDG	4 cut(s)	175, 266, 293, 297
Lsp1109I	GCAGC	1 cut(s)	278
LweI	GCATC	1 cut(s)	174
MaeIII	GTNAC	2 cut(s)	205, 329
MalI	GATC	4 cut(s)	65, 135, 186, 249
MboI	GATC	4 cut(s)	63, 133, 184, 247
MfeI	CAATTG	1 cut(s)	11
MflI	RGATCY	1 cut(s)	63
MluCI	AATT	2 cut(s)	11, 117
MlyI	GAGTC	1 cut(s)	326
MnlI	CCTC	3 cut(s)	19, 44, 97
MseI	TTAA	2 cut(s)	192, 227
MunI	CAATTG	1 cut(s)	11
MvnI	CGCG	1 cut(s)	221
NcoI	CCATGG	1 cut(s)	270
NdeII	GATC	4 cut(s)	63, 133, 184, 247
NlaIII	CATG	1 cut(s)	274
NmuCI	GTSAC	2 cut(s)	205, 329
PfeI	GAWTC	1 cut(s)	95
PkrI	GCNGC	1 cut(s)	268
PleI	GAGTC	1 cut(s)	326
PpsI	GAGTC	1 cut(s)	326
PspPI	GGNCC	1 cut(s)	310
PsuI	RGATCY	1 cut(s)	63
SaqAI	TTAA	2 cut(s)	192, 227
SatI	GCNGC	1 cut(s)	267
Sau3AI	GATC	4 cut(s)	63, 133, 184, 247
Sau96I	GGNCC	1 cut(s)	310
SchI	GAGTC	1 cut(s)	326
SetI	ASST	5 cut(s)	148, 202, 255, 293, 312
SfaNI	GCATC	1 cut(s)	174
SinI	GGWCC	1 cut(s)	310
SmlI	CTYRAG	2 cut(s)	23, 88
SmoI	CTYRAG	2 cut(s)	23, 88
Sse9I	AATT	2 cut(s)	11, 117
SsiI	CCGC	2 cut(s)	126, 221
SspI	AATATT	2 cut(s)	73, 176
StyI	CCWWGG	1 cut(s)	270
TasI	AATT	2 cut(s)	11, 117
TfiI	GAWTC	1 cut(s)	95
Tru1I	TTAA	2 cut(s)	192, 227
Tru9I	TTAA	2 cut(s)	192, 227
TseFI	GTSAC	2 cut(s)	205, 329
TseI	GCWGC	1 cut(s)	266
Tsp45I	GTSAC	2 cut(s)	205, 329
TspDTI	ATGAA	2 cut(s)	129, 203
TspGWI	ACGGA	1 cut(s)	76
VpaK11BI	GGWCC	1 cut(s)	310
XagI	CCTNNNNNAGG	1 cut(s)	141

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.