Rmu_sc0002380.1_g000009

Callose synthase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002380.1
Physical Location & Seq
Forward (+)
44306 .. 59005
14700 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002380.1_g000009.1.cds

Sequence Viewer

Length: 5931 bp
atgtcgtcgtcgagagcggggccggatcaggggccgccgccgcagcggcgtatccagcggacgcagacagctggaaacctcggggaggcggctttcgacagtgaggtggtgccgtcatcgctagtcgaaatcgctcccattcttcgtgtggccaacgaggtggaatcgcacaatcccagagttgcttatctatgtcgattttatgcctttgagaaagctcataggttggatcccacttctagtggacgtggtgttcgtcagttcaaaactgctcttcttcaacgtcttgaaagggagaatgatccaactcttatgggaagggtaaaaaaaagtgatgcacgtgaaatgcagagcttctatcaacactattacaaaaaatatattcaagctttgcaaaatgcagccgataaagctgaccgtgcacaacttaccaaggcataccagactgccaatgttctatttgaggttttaaaggctgttaatatgacacaatctatggaagttgatcgtgagattttggaagctcatgataaagttgcagaaaagacagagctattggttccttacaatatccttccacttgatcctgatagtgtaaatcaagcaattatgagatacccagagattcaagctgctgttgttgctcttcgtaacaccaggggtcttccttggcctaaggaatacaaaaagaaaaaagacgaggatgttcttgattggctgcagtcaatgtttgggtttcagaaggacaatgtggcgaatcaacgggagcacctgatattgttacttgcaaatgtgcacataaggcagtttccaaagcctgatcaacagcccaagttggatgaccgtgccctgacagaagtgatgaagaagcttttcaagaattacaaaaaatggtgcaagttcttgggccggaaaagtagcctttggttaccaaccatacagcaagaggtgcaacagcgcaagctgctttacatgggtctatatcttttgatatggggggaagctgcaaatttgagattcatgccagaatgcctttgttacatttatcatcatatggcatttgaattgtatggtatgttagctgggaatgtgagtccaatgacaggagaaaatgtgaagccagcctatggaggtgaagaagaggctttcttgaaaaaagttgtgactcctatctataacgtgattgccagggaagctgataggagcaaaagaggggaatcaaagcattcccagtggaggaactatgatgatataaatgaatacttttggtcagtggattgtttccggttgggttggccgatgcgtgcagatgctgatttcttttgctgctctagtgaacaacgtcattttgataaaaatagtgaggataacaaaccagctagtggagatcgatgggtggggaaagttaactttgttgagatacggtcattctggcatatctttagaagctttgaccgcatgtggagtttctttattctatgtttacaggttatgataattgttgcttggaatggctcgggccaacccacatcaatattttctgccgatgtattcaagaaagctttgagtgtctttataactgctgcaatattgaagcttggacaagctgttctagatgtaattcttagctggaagtctaggcggagtatgtcattccatgttaagttgagatatattgctaaggtcatttcagctgctgcgtgggtaataattctaccggttacttatgcgtatacttgggaaaaccctcctgggtttgctcagaccattaaaggttggtttggcaatagtaaaaacgcgccctccttgttcatcttggctgttgttatctacttgtcaccgaatatgctggctggggtgttgtttcttttcccatttattcgccgattccttgagagatcaaactataggattgtgatgcttatgatgtggtggtcacagcctcgtctctatgttgggaggggaatgcatgagagcacattttctcttttcaagtacacgatgttttgggttctccttgtagtcacaaagttggcattcagttactatatagagataaagcctttagtgggtccaacaaaagccatcatgaatgtacgtataactaatttccagtggcatgagttctttccccgtgcaaagaacaatatcggtgttgtgattgcactctgggctccaattatcctggtctattttatggatacccagatttggtatgcaatatactccacaatattcggaggaatttatggtgcattccgtcgccttggagagatacggacactaggaatgctaagatctcgctttgaatcattgcctggtgcttttaacgcccgtttaattccagcggacaagagtgagccaaagaagaaaggactgaaggctacattgtcccgcacctttggtcatgttgaaggtagtaaagacaaacaggctgcaaggtttgcgcaattatggaacaaaataataagtagtttcagagaggaggatcttataaaccaaagggagatgaaccttttgcttgttccttattgggctgatcgtgaaatggacctcatacggtggcctccatttttacttgctagcaagatcccgatagcattagacatggccaaggacagcaatggcaaggataaagagctaacaaaaagaatcctggctgatgaatacatgcattgtgctgttcgcgaatgctatgcttcatttaagaacataattaagtttctggttcagggggaccgtgagaaagaggttataaattccatattttctgaggttgacaagcacatagaagatggtgacctgatccgtgaattgaagatgagtgctcttcctagcctctatgaccactttgttcgccttatcaactttttgagcaagaatagtcaggacgacagggatcaagttgtgattctattccaggacatgctggaggtagtgactagagatataatgatggaggagcagataaactgcttggtagattcagtccacggaggctcgggccatgaggggatgatgccccttgatcaacatcaacagcatcagttgtttgcatctgctggagctatcaactttccacttacacatgtaacagaggcttggaaggagaagattaaccgtctttttctattacttaccacaaatcttacacatgtaacagaggcttggaaggagaagattaaccgtctttttctattacttaccacaaaggagtctgccatggacgtgccatccaacttagaagctagaaggcgaatttctttcttctcgaattcattgtttatggatatgcctccagcaccaaaagttcgcaatatgctttctttctctgttttaactccttactacaacgaggaggttctcttttccattgacggtctggaaaaaccgaatgaagatggtgtttctattctcttctacttgcaaaagattttcccagatgaatggaacaactttcttgagcgtgtgaaatgcagcaacgaagaggaactaaaaggttctgatgaattggaagaagaacttcgcctatgggcatcatatagaggccaaactttgactcgtactgtaagagggatgatgtactaccggaaagctttggagcttcaggcttttctggatatggccaaagaggaggatttaatggaaggctataaggccatagagttgaattcagaagatcaatcaaaggagggaagatcactatgggcgcaatgtcaagcagtagctgatatgaaattcacatatgtggtttcatgccaaaagtatggtattcagaagcgatctggtgatcttcgtgcacaggacattctgaggctcatgacaacatacccatcattacgagtggcatatattgatgaggttgaagaacctagcaaagataggtctcagaagataaaccaaaaggcttattattctactttggtaaaggctgctatgccaaagtcaattgacccttcagagccagtacaaaatcttgaccaggttatttatcgcataaagcttccaggacctgctattttgggagagggaaagccagaaaatcaaaatcatgccattattttcacgcgtggagaaggcttgcaaacaattgacatgaaccaggataactacatggaagaagctttgaaaatgaggaatttgctgcaagaatttcttaagcatgatggcgtgaggcaccctacaattcttggacttagggagcatatatttacaggaagtgtttcttctctagcttggttcatgtcaaatcaggagaacagttttgtgactattggtcaaagactattggccaacccactcagggttcgatttcattatgggcatcccgatgtatttgataggctctttcaccttagtagagggggtgttagtaaggcatccaaggttatcaatttgagtgaagacatttttgctggctttaattccactctccgtgaaggcaatgtaactcatcacgaatacatacaagtggggaaggggagagatgtcggtcttaaccaaatctccatgtttgaggcaaaaattgctaatggcaacggggagcagacactcagtcgagatatataccgacttggacatcgttttgactttttccgtatgttgtcatgttatttcaccacaattggtttctacttcagtactctgatcactgtgcttacagtgtatgtcttcctttatggtcgcctctacctggttcttagtggacttgaagaaggtttgaacactcaagcagcaattcgagataataagcctcttcaagttgctctcgcttctcaatcatttgttcaaatagggtttttgatggctttgcctatgttgatggaaattggcttggaaaagggtttccgaactgcattaagtgaattcgtgttgatgcaattgcaactggccccagtatttttcacattctcacttgggacaaagacccactattatggacggacattactgcatggtggtgccaaatatagatctacaggtcgtgggtttgtggtgttccatgccaagtttgccgacaactataggctctactcccgcagccactttgttaagggtattgagctcttgattttacttgtggtgtaccagatctttggtcatacttacagaagtgctgttgcctacattttgatcactgtatctatgtggtttatggtggttacctggctttttgctccctttctgttcaatccatctggttttgagtggcaaaagattgttgatgattggactgattggaataagtggataagcaaccgtggaggtataggtgttccgcctgaaaaaagttgggaatcatggtgggaggaggaacaagaacatcttcgatattccggaaaacgtggcattgtagttgagatactgctatctgtacgattctttatctatcagtatgggcttgtatatcacttaaacattgcaaagaaaaccaagagtgtcctggtctatggtatctcatggctggtgatcgtccttattttgtttgtcatgaagactgtatctgttggtaggagaaagttcagtgctgagtaccaacttgtattccggctgatcaagggattaatattcattacttttgtatccattttggtcactttgattgtgctgcctcacatgaccctgcaggacatcattgtttgcattcttgctttcatgccaactggttgggggatgcttatgattgcccaagcttgcaaaggcttggttcacaaagctggtttatggccatcagttcggactcttgcccgtggctttgagatagttatgggcttgcttctgttcaccccagttgcattcttggcctggtttccttttgtttcagaatttcaaactcgtatgctcttcaaccaagcattcagtagaggtttacagatttctcgtattcttggcggacaacgcaaggatcgttcatcccggaacaaggagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1976

Amino Acids

228.13

Weight (kDa)

9.19

Isoelectric Point (pI)

41.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 3 cut(s) 1577, 2495, 2756
Acc16I TGCGCA 1 cut(s) 2448
Acc36I ACCTGC 1 cut(s) 4021
AccB1I GGYRCC 3 cut(s) 109, 4176, 4961
AccB7I CCANNNNNTGG 2 cut(s) 1127, 1382
AccBSI CCGCTC 1 cut(s) 17
AccI GTMKAC 1 cut(s) 1733
AccII CGCG 3 cut(s) 1799, 2688, 4069
AccIII TCCGGA 1 cut(s) 5336
AcoI YGGCCR 6 cut(s) 150, 1295, 2610, 3624, 4290, 5726
AcuI CTGAAG 4 cut(s) 2399, 3590, 3942, 4621
AcvI CACGTG 1 cut(s) 341
AfaI GTAC 9 cut(s) 1997, 2097, 3565, 3584, 3969, 4642, 5087, 5376, 5534
AflII CTTAAG 1 cut(s) 4157
AflIII ACRYGT 3 cut(s) 3088, 3154, 4067
AgeI ACCGGT 1 cut(s) 1717
AhdI GACNNNNNGTC 2 cut(s) 4275, 4554
AjiI CACGTC 2 cut(s) 248, 3229
AleI CACNNNNGTG 1 cut(s) 3746
AloI GAACNNNNNNTCC 4 cut(s) 237, 269, 1593, 1625
Alw21I GWGCWC 7 cut(s) 424, 771, 798, 1979, 2830, 3802, 5067
Alw26I GTCTC 2 cut(s) 1952, 3891
Alw44I GTGCAC 3 cut(s) 420, 794, 3798
AlwNI CAGNNNCTG 4 cut(s) 1313, 1697, 3728, 4013
Ama87I CYCGRG 3 cut(s) 80, 1516, 3001
Aor13HI TCCGGA 1 cut(s) 5336
ApaLI GTGCAC 3 cut(s) 420, 794, 3798
ArsI GACNNNNNNTTYG 2 cut(s) 237, 269
AseI ATTAAT 1 cut(s) 5564
AsiGI ACCGGT 1 cut(s) 1717
Asp700I GAANNNNTTC 4 cut(s) 872, 3522, 4222, 5325
AspLEI GCGC 4 cut(s) 960, 1801, 2449, 3712
AsuC2I CCSGG 1 cut(s) 5917
AsuHPI GGTGA 8 cut(s) 1145, 1830, 2810, 3800, 4343, 4609, 5479, 5776
AsuNHI GCTAGC 1 cut(s) 2582
AvaI CYCGRG 3 cut(s) 80, 1516, 3001
AvaII GGWCC 4 cut(s) 2072, 2551, 2737, 4010
AxyI CCTNAGG 1 cut(s) 675
BaeGI GKGCMC 4 cut(s) 424, 798, 850, 3802
BaeI ACNNNNGTAYC 2 cut(s) 5565, 5598
BalI TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
BamHI GGATCC 1 cut(s) 229
BanI GGYRCC 3 cut(s) 109, 4176, 4961
BanII GRGCYC 2 cut(s) 2176, 5067
BbrPI CACGTG 1 cut(s) 341
BbsI GAAGAC 4 cut(s) 656, 4410, 4663, 5501
Bbv12I GWGCWC 7 cut(s) 424, 771, 798, 1979, 2830, 3802, 5067
BceAI ACGGC 1 cut(s) 97
BcgI CGANNNNNNTGC 2 cut(s) 2678, 2712
BciVI GTATCC 3 cut(s) 62, 2194, 5593
BclI TGATCA 5 cut(s) 820, 3028, 4647, 5133, 5553
BcnI CCSGG 1 cut(s) 5917
BcoDI GTCTC 2 cut(s) 1952, 3891
BfmI CTRYAG 5 cut(s) 719, 1906, 4977, 5023, 5624
BfrI CTTAAG 1 cut(s) 4157
BfuAI ACCTGC 1 cut(s) 4021
BfuI GTATCC 3 cut(s) 62, 2194, 5593
BglI GCCNNNNNGGC 1 cut(s) 46
BglII AGATCT 3 cut(s) 2297, 4973, 5091
BmcAI AGTACT 1 cut(s) 4642
Bme18I GGWCC 4 cut(s) 2072, 2551, 2737, 4010
BmeRI GACNNNNNGTC 2 cut(s) 4275, 4554
BmeT110I CYCGRG 3 cut(s) 80, 1516, 3001
BmgBI CACGTC 2 cut(s) 248, 3229
BmrI ACTGGG 3 cut(s) 1225, 4889, 5783
BmtI GCTAGC 1 cut(s) 2586
BmuI ACTGGG 3 cut(s) 1225, 4889, 5783
BpiI GAAGAC 4 cut(s) 656, 4410, 4663, 5501
BpmI CTGGAG 3 cut(s) 2951, 3084, 3282
Bpu10I CCTNAGC 1 cut(s) 1680
BpuEI CTTGAG 3 cut(s) 1913, 3482, 4713
BpuMI CCSGG 1 cut(s) 5917
Bsa29I ATCGAT 1 cut(s) 1390
BsaAI YACGTR 2 cut(s) 341, 2099
BsaBI GATNNNNATC 1 cut(s) 3033
BsaI GGTCTC 1 cut(s) 3891
BsaWI WCCGGW 4 cut(s) 1284, 1717, 3588, 5336
BsaXI ACNNNNNCTCC 6 cut(s) 1098, 1128, 1787, 1817, 4490, 4520
Bse118I RCCGGY 1 cut(s) 1717
Bse1I ACTGG 7 cut(s) 1231, 2113, 3965, 4893, 4895, 5668, 5789
Bse21I CCTNAGG 1 cut(s) 675
Bse3DI GCAATG 5 cut(s) 2312, 2629, 3719, 4450, 5418
Bse8I GATNNNNATC 1 cut(s) 3033
BseAI TCCGGA 1 cut(s) 5336
BseCI ATCGAT 1 cut(s) 1390
BseGI GGATG 9 cut(s) 709, 844, 3021, 3233, 3582, 4324, 4379, 5679, 5912
BseJI GATNNNNATC 1 cut(s) 3033
BseMI GCAATG 5 cut(s) 2312, 2629, 3719, 4450, 5418
BseMII CTCAG 7 cut(s) 1775, 2763, 3803, 3902, 4315, 4567, 5520
BseNI ACTGG 7 cut(s) 1231, 2113, 3965, 4893, 4895, 5668, 5789
BseRI GAGGAG 5 cut(s) 2498, 2975, 3371, 3647, 5324
BseSI GKGCMC 4 cut(s) 424, 798, 850, 3802
BseYI CCCAGC 2 cut(s) 1082, 1853
BsgI GTGCAG 1 cut(s) 1326
Bsh1236I CGCG 3 cut(s) 1799, 2688, 4069
BshNI GGYRCC 3 cut(s) 109, 4176, 4961
BshTI ACCGGT 1 cut(s) 1717
BshVI ATCGAT 1 cut(s) 1390
BsiHKAI GWGCWC 7 cut(s) 424, 771, 798, 1979, 2830, 3802, 5067
BsiHKCI CYCGRG 3 cut(s) 80, 1516, 3001
BsiSI CCGG 8 cut(s) 23, 910, 1285, 1718, 3589, 5337, 5548, 5917
BslFI GGGAC 3 cut(s) 2377, 2750, 4933
BsmAI GTCTC 2 cut(s) 1952, 3891
BsmBI CGTCTC 1 cut(s) 1952
BsmFI GGGAC 3 cut(s) 2377, 2750, 4933
Bso31I GGTCTC 1 cut(s) 3891
BsoBI CYCGRG 3 cut(s) 80, 1516, 3001
Bsp1286I GDGCHC 9 cut(s) 424, 771, 798, 850, 1979, 2176, 2830, 3802, 5067
Bsp13I TCCGGA 1 cut(s) 5336
Bsp19I CCATGG 1 cut(s) 3222
Bsp68I TCGCGA 1 cut(s) 2688
BspCNI CTCAG 7 cut(s) 1774, 2764, 3804, 3901, 4314, 4566, 5521
BspDI ATCGAT 1 cut(s) 1390
BspEI TCCGGA 1 cut(s) 5336
BspFNI CGCG 3 cut(s) 1799, 2688, 4069
BspHI TCATGA 4 cut(s) 526, 2088, 3819, 5490
BspMAI CTGCAG 2 cut(s) 723, 5628
BspMI ACCTGC 1 cut(s) 4021
BspOI GCTAGC 1 cut(s) 2586
BspQI GCTCTTC 4 cut(s) 279, 651, 2835, 5849
BspT107I GGYRCC 3 cut(s) 109, 4176, 4961
BspTI CTTAAG 1 cut(s) 4157
BspTNI GGTCTC 1 cut(s) 3891
BsrBI CCGCTC 1 cut(s) 17
BsrDI GCAATG 5 cut(s) 2312, 2629, 3719, 4450, 5418
BsrFI RCCGGY 1 cut(s) 1717
BsrI ACTGG 7 cut(s) 1231, 2113, 3965, 4893, 4895, 5668, 5789
BssAI RCCGGY 1 cut(s) 1717
BssNAI GTATAC 1 cut(s) 1734
BssT1I CCWWGG 6 cut(s) 432, 668, 2266, 2613, 3222, 4383
Bst1107I GTATAC 1 cut(s) 1734
Bst6I CTCTTC 8 cut(s) 279, 651, 1134, 2835, 3422, 3480, 4761, 5849
BstAFI CTTAAG 1 cut(s) 4157
BstAPI GCANNNNNTGC 3 cut(s) 949, 2444, 4526
BstBAI YACGTR 2 cut(s) 341, 2099
BstC8I GCNNGC 9 cut(s) 962, 1122, 1305, 1851, 2584, 4082, 4417, 5695, 5774
BstDSI CCRYGG 4 cut(s) 2992, 3222, 5260, 5749
BstEII GGTNACC 3 cut(s) 927, 2798, 5161
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 9 cut(s) 709, 844, 3021, 3233, 3582, 4324, 4379, 5679, 5912
BstFNI CGCG 3 cut(s) 1799, 2688, 4069
BstHHI GCGC 4 cut(s) 960, 1801, 2449, 3712
BstMAI GTCTC 2 cut(s) 1952, 3891
BstNSI RCATGY 5 cut(s) 1462, 2674, 2929, 3092, 3158
BstPI GGTNACC 3 cut(s) 927, 2798, 5161
BstSFI CTRYAG 5 cut(s) 719, 1906, 4977, 5023, 5624
BstSLI GKGCMC 4 cut(s) 424, 798, 850, 3802
BstSNI TACGTA 1 cut(s) 2099
BstUI CGCG 3 cut(s) 1799, 2688, 4069
BstV2I GAAGAC 4 cut(s) 656, 4410, 4663, 5501
BstX2I RGATCY 6 cut(s) 229, 2297, 2488, 2589, 4973, 5091
BstXI CCANNNNNNTGG 6 cut(s) 160, 3447, 3767, 4937, 5096, 5667
BstYI RGATCY 6 cut(s) 229, 2297, 2488, 2589, 4973, 5091
BstZ17I GTATAC 1 cut(s) 1734
Bsu15I ATCGAT 1 cut(s) 1390
Bsu36I CCTNAGG 1 cut(s) 675
BsuI GTATCC 3 cut(s) 62, 2194, 5593
BsuTUI ATCGAT 1 cut(s) 1390
BtgI CCRYGG 4 cut(s) 2992, 3222, 5260, 5749
BtgZI GCGATG 1 cut(s) 102
BtrI CACGTC 2 cut(s) 248, 3229
BtsCI GGATG 9 cut(s) 709, 844, 3021, 3233, 3582, 4324, 4379, 5679, 5912
BtsIMutI CAGTG 8 cut(s) 106, 1238, 1278, 2120, 4650, 4668, 5136, 5530
BtuMI TCGCGA 1 cut(s) 2688
BveI ACCTGC 1 cut(s) 4021
Cac8I GCNNGC 9 cut(s) 962, 1122, 1305, 1851, 2584, 4082, 4417, 5695, 5774
CaiI CAGNNNCTG 4 cut(s) 1313, 1697, 3728, 4013
CciI TCATGA 4 cut(s) 526, 2088, 3819, 5490
CfoI GCGC 4 cut(s) 960, 1801, 2449, 3712
Cfr10I RCCGGY 1 cut(s) 1717
ClaI ATCGAT 1 cut(s) 1390
CseI GACGC 1 cut(s) 70
CsiI ACCWGGT 2 cut(s) 3981, 4692
Csp6I GTAC 9 cut(s) 1996, 2096, 3564, 3583, 3968, 4641, 5086, 5375, 5533
CspAI ACCGGT 1 cut(s) 1717
CviQI GTAC 9 cut(s) 1996, 2096, 3564, 3583, 3968, 4641, 5086, 5375, 5533
DraI TTTAAA 1 cut(s) 471
DriI GACNNNNNGTC 2 cut(s) 4275, 4554
EaeI YGGCCR 6 cut(s) 150, 1295, 2610, 3624, 4290, 5726
Eam1104I CTCTTC 8 cut(s) 279, 651, 1134, 2835, 3422, 3480, 4761, 5849
Eam1105I GACNNNNNGTC 2 cut(s) 4275, 4554
EarI CTCTTC 8 cut(s) 279, 651, 1134, 2835, 3422, 3480, 4761, 5849
EciI GGCGGA 3 cut(s) 1657, 5268, 5907
Ecl136II GAGCTC 1 cut(s) 5065
Eco105I TACGTA 1 cut(s) 2099
Eco130I CCWWGG 6 cut(s) 432, 668, 2266, 2613, 3222, 4383
Eco24I GRGCYC 2 cut(s) 2176, 5067
Eco31I GGTCTC 1 cut(s) 3891
Eco47I GGWCC 4 cut(s) 2072, 2551, 2737, 4010
Eco53kI GAGCTC 1 cut(s) 5065
Eco57I CTGAAG 4 cut(s) 2399, 3590, 3942, 4621
Eco72I CACGTG 1 cut(s) 341
Eco81I CCTNAGG 1 cut(s) 675
Eco88I CYCGRG 3 cut(s) 80, 1516, 3001
Eco91I GGTNACC 3 cut(s) 927, 2798, 5161
EcoICRI GAGCTC 1 cut(s) 5065
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoO109I RGGNCCY 1 cut(s) 4010
EcoO65I GGTNACC 3 cut(s) 927, 2798, 5161
EcoRI GAATTC 3 cut(s) 3274, 3670, 4865
EcoT14I CCWWGG 6 cut(s) 432, 668, 2266, 2613, 3222, 4383
EcoT22I ATGCAT 2 cut(s) 1971, 2676
EcoT38I GRGCYC 2 cut(s) 2176, 5067
ErhI CCWWGG 6 cut(s) 432, 668, 2266, 2613, 3222, 4383
Esp3I CGTCTC 1 cut(s) 1952
FalI AAGNNNNNCTT 8 cut(s) 3507, 3539, 4140, 4172, 4210, 4242, 5310, 5342
FaqI GGGAC 3 cut(s) 2377, 2750, 4933
FauI CCCGC 3 cut(s) 10, 2402, 5045
FauNDI CATATG 2 cut(s) 1053, 3745
FbaI TGATCA 5 cut(s) 820, 3028, 4647, 5133, 5553
FblI GTMKAC 1 cut(s) 1733
FokI GGATG 9 cut(s) 716, 851, 3028, 3220, 3589, 4311, 4366, 5686, 5899
FriOI GRGCYC 2 cut(s) 2176, 5067
FspI TGCGCA 1 cut(s) 2448
GlaI GCGC 4 cut(s) 959, 1800, 2448, 3711
GsaI CCCAGC 2 cut(s) 1086, 1857
GsuI CTGGAG 3 cut(s) 2951, 3084, 3282
HapII CCGG 8 cut(s) 23, 910, 1285, 1718, 3589, 5337, 5548, 5917
HgaI GACGC 1 cut(s) 70
HhaI GCGC 4 cut(s) 960, 1801, 2449, 3712
Hin6I GCGC 4 cut(s) 958, 1799, 2447, 3710
HinP1I GCGC 4 cut(s) 958, 1799, 2447, 3710
HincII GTYRAC 2 cut(s) 1408, 2779
HindII GTYRAC 2 cut(s) 1408, 2779
HindIII AAGCTT 9 cut(s) 387, 869, 1447, 1560, 1595, 3594, 4001, 4122, 5691
HpaI GTTAAC 1 cut(s) 1408
HpaII CCGG 8 cut(s) 23, 910, 1285, 1718, 3589, 5337, 5548, 5917
HphI GGTGA 8 cut(s) 1145, 1830, 2810, 3800, 4343, 4609, 5479, 5776
Hpy99I CGWCG 3 cut(s) 10, 13, 2265
HpyCH4IV ACGT 8 cut(s) 247, 283, 340, 1179, 1342, 2098, 3228, 5344
HpySE526I ACGT 8 cut(s) 247, 283, 340, 1179, 1342, 2098, 3228, 5344
HspAI GCGC 4 cut(s) 958, 1799, 2447, 3710
Kpn2I TCCGGA 1 cut(s) 5336
Ksp22I TGATCA 5 cut(s) 820, 3028, 4647, 5133, 5553
KspAI GTTAAC 1 cut(s) 1408
LguI GCTCTTC 4 cut(s) 279, 651, 2835, 5849
MabI ACCWGGT 2 cut(s) 3981, 4692
MaeII ACGT 8 cut(s) 247, 283, 340, 1179, 1342, 2098, 3228, 5344
MbiI CCGCTC 1 cut(s) 17
MfeI CAATTG 4 cut(s) 3948, 4089, 4623, 4880
MflI RGATCY 6 cut(s) 229, 2297, 2488, 2589, 4973, 5091
MhlI GDGCHC 9 cut(s) 424, 771, 798, 850, 1979, 2176, 2830, 3802, 5067
MlsI TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
MluI ACGCGT 1 cut(s) 4067
MluNI TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
MlyI GAGTC 5 cut(s) 1102, 1159, 3224, 3553, 5734
MmeI TCCRAC 5 cut(s) 207, 329, 816, 2099, 3261
Mox20I TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
Mph1103I ATGCAT 2 cut(s) 1971, 2676
MroI TCCGGA 1 cut(s) 5336
MroXI GAANNNNTTC 4 cut(s) 872, 3522, 4222, 5325
MscI TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
MslI CAYNNNNRTG 6 cut(s) 3227, 3746, 4329, 4469, 4935, 4959
Msp20I TGGCCA 5 cut(s) 152, 2612, 3626, 4292, 5728
MspA1I CMGCKG 5 cut(s) 46, 58, 71, 1694, 2348
MspCI CTTAAG 1 cut(s) 4157
MspI CCGG 8 cut(s) 23, 910, 1285, 1718, 3589, 5337, 5548, 5917
MunI CAATTG 4 cut(s) 3948, 4089, 4623, 4880
MvnI CGCG 3 cut(s) 1799, 2688, 4069
NciI CCSGG 1 cut(s) 5917
NcoI CCATGG 1 cut(s) 3222
NdeI CATATG 2 cut(s) 1053, 3745
NheI GCTAGC 1 cut(s) 2582
NmuCI GTSAC 8 cut(s) 1162, 1836, 1935, 2023, 2798, 2938, 4267, 5593
NruI TCGCGA 1 cut(s) 2688
NsbI TGCGCA 1 cut(s) 2448
NsiI ATGCAT 2 cut(s) 1971, 2676
NspI RCATGY 5 cut(s) 1462, 2674, 2929, 3092, 3158
OliI CACNNNNGTG 1 cut(s) 3746
PagI TCATGA 4 cut(s) 526, 2088, 3819, 5490
PciI ACATGT 2 cut(s) 3088, 3154
PciSI GCTCTTC 4 cut(s) 279, 651, 2835, 5849
PcsI WCGNNNNNNNCGW 2 cut(s) 253, 5905
PdmI GAANNNNTTC 4 cut(s) 872, 3522, 4222, 5325
PflMI CCANNNNNTGG 2 cut(s) 1127, 1382
PfoI TCCNGGA 3 cut(s) 2919, 4006, 5915
PinAI ACCGGT 1 cut(s) 1717
PleI GAGTC 5 cut(s) 1101, 1159, 3223, 3553, 5734
PmaCI CACGTG 1 cut(s) 341
PmlI CACGTG 1 cut(s) 341
PpsI GAGTC 5 cut(s) 1101, 1159, 3223, 3553, 5734
Ppu21I YACGTR 2 cut(s) 341, 2099
PpuMI RGGWCCY 1 cut(s) 4010
PscI ACATGT 2 cut(s) 3088, 3154
PshBI ATTAAT 1 cut(s) 5564
PsiI TTATAA 3 cut(s) 1577, 2495, 2756
Psp124BI GAGCTC 1 cut(s) 5067
Psp5II RGGWCCY 1 cut(s) 4010
PspCI CACGTG 1 cut(s) 341
PspEI GGTNACC 3 cut(s) 927, 2798, 5161
PspFI CCCAGC 2 cut(s) 1082, 1853
PspPPI RGGWCCY 1 cut(s) 4010
PstI CTGCAG 2 cut(s) 723, 5628
PstNI CAGNNNCTG 4 cut(s) 1313, 1697, 3728, 4013
PsuI RGATCY 6 cut(s) 229, 2297, 2488, 2589, 4973, 5091
PvuII CAGCTG 2 cut(s) 71, 1694
RruI TCGCGA 1 cut(s) 2688
RsaI GTAC 9 cut(s) 1997, 2097, 3565, 3584, 3969, 4642, 5087, 5376, 5534
RsaNI GTAC 9 cut(s) 1996, 2096, 3564, 3583, 3968, 4641, 5086, 5375, 5533
RseI CAYNNNNRTG 6 cut(s) 3227, 3746, 4329, 4469, 4935, 4959
SacI GAGCTC 1 cut(s) 5067
SapI GCTCTTC 4 cut(s) 279, 651, 2835, 5849
SbfI CCTGCAGG 1 cut(s) 5628
ScaI AGTACT 1 cut(s) 4642
SchI GAGTC 5 cut(s) 1102, 1159, 3224, 3553, 5734
SdaI CCTGCAGG 1 cut(s) 5628
SduI GDGCHC 9 cut(s) 424, 771, 798, 850, 1979, 2176, 2830, 3802, 5067
SexAI ACCWGGT 2 cut(s) 3981, 4692
SfcI CTRYAG 5 cut(s) 719, 1906, 4977, 5023, 5624
SinI GGWCC 4 cut(s) 2072, 2551, 2737, 4010
SmiMI CAYNNNNRTG 6 cut(s) 3227, 3746, 4329, 4469, 4935, 4959
SmlI CTYRAG 4 cut(s) 1892, 3461, 4157, 4728
SmoI CTYRAG 4 cut(s) 1892, 3461, 4157, 4728
SnaBI TACGTA 1 cut(s) 2099
Sse8387I CCTGCAGG 1 cut(s) 5628
SspI AATATT 4 cut(s) 1536, 1590, 2235, 5568
SstI GAGCTC 1 cut(s) 5067
StyI CCWWGG 6 cut(s) 432, 668, 2266, 2613, 3222, 4383
TaiI ACGT 8 cut(s) 250, 286, 343, 1182, 1345, 2101, 3231, 5347
TaqII GACCGA 1 cut(s) 4481
TatI WGTACW 4 cut(s) 1995, 3582, 3967, 4640
TauI GCSGC 5 cut(s) 37, 40, 43, 49, 92
TscAI CASTG 8 cut(s) 106, 1238, 1278, 2120, 4657, 4668, 5143, 5530
TseFI GTSAC 8 cut(s) 1162, 1836, 1935, 2023, 2798, 2938, 4267, 5593
Tsp45I GTSAC 8 cut(s) 1162, 1836, 1935, 2023, 2798, 2938, 4267, 5593
TspGWI ACGGA 7 cut(s) 2249, 2293, 2798, 3009, 4424, 4586, 4957
TspRI CASTG 8 cut(s) 106, 1238, 1278, 2120, 4657, 4668, 5143, 5530
Van91I CCANNNNNTGG 2 cut(s) 1127, 1382
Vha464I CTTAAG 1 cut(s) 4157
VneI GTGCAC 3 cut(s) 420, 794, 3798
VpaK11BI GGWCC 4 cut(s) 2072, 2551, 2737, 4010
VspI ATTAAT 1 cut(s) 5564
XagI CCTNNNNNAGG 1 cut(s) 83
XbaI TCTAGA 1 cut(s) 1612
XceI RCATGY 5 cut(s) 1462, 2674, 2929, 3092, 3158
XcmI CCANNNNNNNNNTGG 3 cut(s) 145, 3379, 5440
XmiI GTMKAC 1 cut(s) 1733
XmnI GAANNNNTTC 4 cut(s) 872, 3522, 4222, 5325
ZrmI AGTACT 1 cut(s) 4642
Zsp2I ATGCAT 2 cut(s) 1971, 2676
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.