Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002483.1

Orthogroup ID

OG0007057

Physical Location & Seq

Genomic Coordinates Reverse (-)

20790 .. 22371

Gene Structure 1582 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002483.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1095 bp

atggagtgctttttcaaaggtgcgaatgaggacttgacgccttctccggtagacattcttcggtgtccgtttttgaggaacattaatgagccaaccaatttttccttctcctccatgtcgtccatggctttcccgatgccggtacgtgcagccagcaaaggtccaatttttgaagatggtcccaatttcgacatggcatttaagcttttccatgggagtgatggagtagtccctctttctggacgatcatttgagcattctgagaaagttgagcatcaaccggccccatgcatgtttaatccattagctgcaaaggcagctactatcagtctctcatcctttggacctggaggacctttcggctttgatgcattctctgagaagtggaagaaaatgcaaaagaagtctaattcctcgaaaaagggttcttcttcaaagggaggaaactctaatcatgaggcagcgagtaacgagtggctgcaaagtggaaactgtccgattgcaaagtcattccgtgctgttagtggtgtcattccacttgttgcaaaggctttgcagctccctccaggcatgaaagttaagtgcccaccggcaatagttgcagcacgagcagctctggcaaaaactgcatttgcaaagaacctccgcccacaacccctgcctgcaaaagttcttgtgattggagcactgggaatggcagccaatgttcctttagggatatggagagagcacaccaagaaattctctccgtcttggtttgctgctgtgcatgcagctgttccattcatagctgtacttcgaaagtctgtgttgatgcctaagtcggctatggcgtttaccattgcagcatctatattaggacaggtgattgggtctagagcagagcgctaccgtctgaaggcaaaggcggctaaaaccttggcattgactgaaacctctgttcagatcaagaagactgaaacctctgttgttgggatgaaaagccagttccaggtggttgaagcgaaatctgatcattgcactgagattgaggaatggaattcagttgctctgcaggtctcacgcccttcttcatcaaccgatgtgttctgctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

364

Amino Acids

39.08

Weight (kDa)

9.72

Isoelectric Point (pI)

49.79

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007057)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G25030 AT4G25030
fragaria_vesca	FvH4_7g19880 FvH4_7g19880
malus_domestica	MD01G1110900.v1.1 MD05G1255700.v1.1 MD07G1177000.v1.1
prunus_persica	Prupe.2G215800_v2.0.a1
pyrus_communis	pycom01g13820 pycom07g17110
rosa_chinensis	RchiOBHm_Chr1g0363861
rosa_laevigata	RLG00000027540
rosa_multiflora	Rmu_co8207472.1_g000001 Rmu_sc0002483.1_g000002 Rmu_sc0041994.1_g000001
rosa_roxburghii	Rroxscaffold_4G00292910
rosa_rugosa	Rorug01G0310000 Rorug01G0310100 Rorug01G0310200 Rorug01G0310300
rosa_samantha	Rh1AG318400 Rh1BG281600 Rh1CG298000 Rh1DG312900
rosa_wichuraiana	Rw1G028260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	1045
AccI	GTMKAC	1 cut(s)	51
AciI	CCGC	2 cut(s)	646, 908
AcsI	RAATTY	2 cut(s)	740, 1039
AcuI	CTGAAG	1 cut(s)	917
AcyI	GRCGYC	1 cut(s)	38
AfaI	GTAC	2 cut(s)	144, 795
AfeI	AGCGCT	1 cut(s)	887
AfiI	CCNNNNNNNGG	4 cut(s)	139, 239, 898, 991
AgsI	TTSAA	4 cut(s)	16, 173, 435, 1001
AjnI	CCWGG	3 cut(s)	346, 565, 990
AjuI	GAANNNNNNNTTGG	4 cut(s)	85, 89, 117, 121
AluBI	AGCT	7 cut(s)	205, 308, 320, 559, 614, 776, 791
AluI	AGCT	7 cut(s)	205, 308, 320, 559, 614, 776, 791
Alw21I	GWGCWC	2 cut(s)	688, 732
Alw26I	GTCTC	2 cut(s)	335, 1063
Aor51HI	AGCGCT	1 cut(s)	887
AoxI	GGCC	1 cut(s)	282
ApoI	RAATTY	2 cut(s)	740, 1039
AseI	ATTAAT	1 cut(s)	84
AspLEI	GCGC	1 cut(s)	888
AspS9I	GGNCC	5 cut(s)	161, 179, 283, 344, 353
AsuHPI	GGTGA	1 cut(s)	877
AsuII	TTCGAA	1 cut(s)	799
AvaII	GGWCC	4 cut(s)	161, 179, 344, 353
BaeGI	GKGCMC	1 cut(s)	587
BarI	GAAGNNNNNNTAC	2 cut(s)	42, 74
BauI	CACGAG	1 cut(s)	606
BbsI	GAAGAC	1 cut(s)	959
Bbv12I	GWGCWC	2 cut(s)	688, 732
BccI	CCATC	2 cut(s)	170, 215
BciT130I	CCWGG	3 cut(s)	348, 567, 992
BclI	TGATCA	1 cut(s)	1012
BcoDI	GTCTC	2 cut(s)	335, 1063
BfaI	CTAG	1 cut(s)	876
BfmI	CTRYAG	1 cut(s)	1052
BfoI	RGCGCY	1 cut(s)	889
BfuAI	ACCTGC	1 cut(s)	1045
Bme1390I	CCNGG	3 cut(s)	348, 567, 992
Bme18I	GGWCC	4 cut(s)	161, 179, 344, 353
BmgT120I	GGNCC	5 cut(s)	161, 179, 283, 344, 353
BmiI	GGNNCC	2 cut(s)	181, 285
BmrFI	CCNGG	3 cut(s)	348, 567, 992
BmrI	ACTGGG	1 cut(s)	698
BmsI	GCATC	5 cut(s)	126, 283, 358, 804, 857
BmuI	ACTGGG	1 cut(s)	698
BpiI	GAAGAC	1 cut(s)	959
BpmI	CTGGAG	2 cut(s)	369, 549
Bpu14I	TTCGAA	1 cut(s)	799
BsaAI	YACGTR	1 cut(s)	146
BsaHI	GRCGYC	1 cut(s)	38
BsaI	GGTCTC	1 cut(s)	1063
BsaJI	CCNNGG	3 cut(s)	123, 211, 918
BsaWI	WCCGGW	1 cut(s)	46
BsaXI	ACNNNNNCTCC	2 cut(s)	28, 58
Bsc4I	CCNNNNNNNGG	4 cut(s)	139, 239, 898, 991
Bse118I	RCCGGY	3 cut(s)	139, 280, 589
Bse1I	ACTGG	2 cut(s)	693, 985
Bse3DI	GCAATG	2 cut(s)	840, 1015
BseBI	CCWGG	3 cut(s)	348, 567, 992
BseDI	CCNNGG	3 cut(s)	123, 211, 918
BseGI	GGATG	2 cut(s)	335, 981
BseLI	CCNNNNNNNGG	4 cut(s)	139, 239, 898, 991
BseMI	GCAATG	2 cut(s)	840, 1015
BseMII	CTCAG	3 cut(s)	252, 369, 1014
BseNI	ACTGG	2 cut(s)	693, 985
BseRI	GAGGAG	1 cut(s)	100
BseSI	GKGCMC	1 cut(s)	587
BsgI	GTGCAG	1 cut(s)	168
BshFI	GGCC	1 cut(s)	284
BsiHKAI	GWGCWC	2 cut(s)	688, 732
BsiSI	CCGG	4 cut(s)	47, 140, 281, 590
BslFI	GGGAC	2 cut(s)	165, 215
BslI	CCNNNNNNNGG	4 cut(s)	139, 239, 898, 991
BsmAI	GTCTC	2 cut(s)	335, 1063
BsmFI	GGGAC	2 cut(s)	165, 215
BsmI	GAATGC	2 cut(s)	256, 371
BsnI	GGCC	1 cut(s)	284
Bso31I	GGTCTC	1 cut(s)	1063
Bsp119I	TTCGAA	1 cut(s)	799
Bsp1286I	GDGCHC	3 cut(s)	587, 688, 732
Bsp143I	GATC	3 cut(s)	245, 945, 1012
Bsp19I	CCATGG	2 cut(s)	123, 211
BspACI	CCGC	2 cut(s)	646, 908
BspANI	GGCC	1 cut(s)	284
BspCNI	CTCAG	3 cut(s)	253, 370, 1015
BspHI	TCATGA	1 cut(s)	454
BspLI	GGNNCC	2 cut(s)	181, 285
BspMAI	CTGCAG	1 cut(s)	1056
BspMI	ACCTGC	1 cut(s)	1045
BspT104I	TTCGAA	1 cut(s)	799
BspTNI	GGTCTC	1 cut(s)	1063
BsrDI	GCAATG	2 cut(s)	840, 1015
BsrFI	RCCGGY	3 cut(s)	139, 280, 589
BsrI	ACTGG	2 cut(s)	693, 985
BssAI	RCCGGY	3 cut(s)	139, 280, 589
BssECI	CCNNGG	3 cut(s)	123, 211, 918
BssMI	GATC	3 cut(s)	245, 945, 1012
BssNI	GRCGYC	1 cut(s)	38
BssSI	CACGAG	1 cut(s)	606
BssT1I	CCWWGG	3 cut(s)	123, 211, 918
Bst2BI	CACGAG	1 cut(s)	606
Bst2UI	CCWGG	3 cut(s)	348, 567, 992
Bst4CI	ACNGT	2 cut(s)	494, 893
BstACI	GRCGYC	1 cut(s)	38
BstAPI	GCANNNNNTGC	2 cut(s)	599, 626
BstBAI	YACGTR	1 cut(s)	146
BstBI	TTCGAA	1 cut(s)	799
BstC8I	GCNNGC	3 cut(s)	154, 663, 771
BstDEI	CTNAG	4 cut(s)	261, 378, 819, 1023
BstDSI	CCRYGG	2 cut(s)	123, 211
BstF5I	GGATG	2 cut(s)	335, 981
BstH2I	RGCGCY	1 cut(s)	889
BstHHI	GCGC	1 cut(s)	888
BstKTI	GATC	3 cut(s)	248, 948, 1015
BstMAI	GTCTC	2 cut(s)	335, 1063
BstMBI	GATC	3 cut(s)	245, 945, 1012
BstMWI	GCNNNNNNNGC	9 cut(s)	314, 317, 599, 608, 611, 617, 626, 770, 908
BstNI	CCWGG	3 cut(s)	348, 567, 992
BstNSI	RCATGY	2 cut(s)	295, 773
BstSCI	CCNGG	3 cut(s)	346, 565, 990
BstSFI	CTRYAG	1 cut(s)	1052
BstSLI	GKGCMC	1 cut(s)	587
BstV2I	GAAGAC	1 cut(s)	959
BsuRI	GGCC	1 cut(s)	284
BtgI	CCRYGG	2 cut(s)	123, 211
BtsCI	GGATG	2 cut(s)	335, 981
BtsIMutI	CAGTG	2 cut(s)	686, 1020
BveI	ACCTGC	1 cut(s)	1045
Cac8I	GCNNGC	3 cut(s)	154, 663, 771
CciI	TCATGA	1 cut(s)	454
CfoI	GCGC	1 cut(s)	888
Cfr10I	RCCGGY	3 cut(s)	139, 280, 589
Cfr13I	GGNCC	5 cut(s)	161, 179, 283, 344, 353
CseI	GACGC	1 cut(s)	46
Csp6I	GTAC	2 cut(s)	143, 794
CviAII	CATG	9 cut(s)	115, 124, 193, 212, 288, 292, 455, 571, 770
CviQI	GTAC	2 cut(s)	143, 794
DdeI	CTNAG	4 cut(s)	261, 378, 819, 1023
DpnI	GATC	3 cut(s)	247, 947, 1014
DpnII	GATC	3 cut(s)	245, 945, 1012
EciI	GGCGGA	1 cut(s)	635
Eco130I	CCWWGG	3 cut(s)	123, 211, 918
Eco31I	GGTCTC	1 cut(s)	1063
Eco47I	GGWCC	4 cut(s)	161, 179, 344, 353
Eco47III	AGCGCT	1 cut(s)	887
Eco57I	CTGAAG	1 cut(s)	917
EcoO109I	RGGNCCY	1 cut(s)	353
EcoRI	GAATTC	1 cut(s)	1039
EcoRII	CCWGG	3 cut(s)	346, 565, 990
EcoT14I	CCWWGG	3 cut(s)	123, 211, 918
EcoT22I	ATGCAT	2 cut(s)	293, 373
ErhI	CCWWGG	3 cut(s)	123, 211, 918
FaeI	CATG	9 cut(s)	118, 127, 196, 215, 291, 295, 458, 574, 773
FaqI	GGGAC	2 cut(s)	165, 215
FatI	CATG	9 cut(s)	114, 123, 192, 211, 287, 291, 454, 570, 769
FbaI	TGATCA	1 cut(s)	1012
FblI	GTMKAC	1 cut(s)	51
FokI	GGATG	2 cut(s)	322, 988
FspBI	CTAG	1 cut(s)	876
GlaI	GCGC	1 cut(s)	887
GsuI	CTGGAG	2 cut(s)	369, 549
HaeII	RGCGCY	1 cut(s)	889
HaeIII	GGCC	1 cut(s)	284
HapII	CCGG	4 cut(s)	47, 140, 281, 590
HgaI	GACGC	1 cut(s)	46
HhaI	GCGC	1 cut(s)	888
Hin1I	GRCGYC	1 cut(s)	38
Hin1II	CATG	9 cut(s)	118, 127, 196, 215, 291, 295, 458, 574, 773
Hin6I	GCGC	1 cut(s)	886
HinP1I	GCGC	1 cut(s)	886
HindIII	AAGCTT	1 cut(s)	203
HpaII	CCGG	4 cut(s)	47, 140, 281, 590
HphI	GGTGA	1 cut(s)	877
Hpy166II	GTNNAC	2 cut(s)	52, 837
Hpy188I	TCNGA	6 cut(s)	262, 379, 498, 897, 945, 1012
Hpy188III	TCNNGA	5 cut(s)	133, 240, 455, 876, 949
Hpy8I	GTNNAC	2 cut(s)	52, 837
HpyAV	CCTTC	4 cut(s)	51, 115, 892, 1077
HpyCH4III	ACNGT	2 cut(s)	494, 893
HpyCH4IV	ACGT	1 cut(s)	145
HpyF10VI	GCNNNNNNNGC	9 cut(s)	314, 317, 599, 608, 611, 617, 626, 770, 908
HpyF3I	CTNAG	4 cut(s)	261, 378, 819, 1023
HpySE526I	ACGT	1 cut(s)	145
Hsp92I	GRCGYC	1 cut(s)	38
Hsp92II	CATG	9 cut(s)	118, 127, 196, 215, 291, 295, 458, 574, 773
HspAI	GCGC	1 cut(s)	886
Ksp22I	TGATCA	1 cut(s)	1012
Kzo9I	GATC	3 cut(s)	245, 945, 1012
LmnI	GCTCC	2 cut(s)	564, 683
LweI	GCATC	5 cut(s)	126, 283, 358, 804, 857
MaeI	CTAG	1 cut(s)	876
MaeII	ACGT	1 cut(s)	145
MaeIII	GTNAC	1 cut(s)	467
MalI	GATC	3 cut(s)	247, 947, 1014
MboI	GATC	3 cut(s)	245, 945, 1012
MboII	GAAGA	7 cut(s)	50, 185, 400, 420, 423, 964, 1062
MhlI	GDGCHC	3 cut(s)	587, 688, 732
MluCI	AATT	6 cut(s)	97, 165, 184, 409, 740, 1039
Mph1103I	ATGCAT	2 cut(s)	293, 373
MseI	TTAA	4 cut(s)	84, 201, 297, 579
MslI	CAYNNNNRTG	1 cut(s)	216
MspA1I	CMGCKG	1 cut(s)	776
MspI	CCGG	4 cut(s)	47, 140, 281, 590
MspR9I	CCNGG	3 cut(s)	348, 567, 992
Mva1269I	GAATGC	2 cut(s)	256, 371
MvaI	CCWGG	3 cut(s)	348, 567, 992
MwoI	GCNNNNNNNGC	9 cut(s)	314, 317, 599, 608, 611, 617, 626, 770, 908
NcoI	CCATGG	2 cut(s)	123, 211
NdeII	GATC	3 cut(s)	245, 945, 1012
NlaIII	CATG	9 cut(s)	118, 127, 196, 215, 291, 295, 458, 574, 773
NlaIV	GGNNCC	2 cut(s)	181, 285
NsiI	ATGCAT	2 cut(s)	293, 373
NspI	RCATGY	2 cut(s)	295, 773
NspV	TTCGAA	1 cut(s)	799
PaeI	GCATGC	1 cut(s)	773
PagI	TCATGA	1 cut(s)	454
PcsI	WCGNNNNNNNCGW	1 cut(s)	830
PctI	GAATGC	2 cut(s)	256, 371
Ppu21I	YACGTR	1 cut(s)	146
PpuMI	RGGWCCY	1 cut(s)	353
PshBI	ATTAAT	1 cut(s)	84
Psp5II	RGGWCCY	1 cut(s)	353
Psp6I	CCWGG	3 cut(s)	346, 565, 990
PspGI	CCWGG	3 cut(s)	346, 565, 990
PspN4I	GGNNCC	2 cut(s)	181, 285
PspPI	GGNCC	5 cut(s)	161, 179, 283, 344, 353
PspPPI	RGGWCCY	1 cut(s)	353
PstI	CTGCAG	1 cut(s)	1056
PvuII	CAGCTG	1 cut(s)	776
RsaI	GTAC	2 cut(s)	144, 795
RsaNI	GTAC	2 cut(s)	143, 794
RseI	CAYNNNNRTG	1 cut(s)	216
SaqAI	TTAA	4 cut(s)	84, 201, 297, 579
Sau3AI	GATC	3 cut(s)	245, 945, 1012
Sau96I	GGNCC	5 cut(s)	161, 179, 283, 344, 353
ScrFI	CCNGG	3 cut(s)	348, 567, 992
SduI	GDGCHC	3 cut(s)	587, 688, 732
SfaNI	GCATC	5 cut(s)	126, 283, 358, 804, 857
SfcI	CTRYAG	1 cut(s)	1052
SfuI	TTCGAA	1 cut(s)	799
SinI	GGWCC	4 cut(s)	161, 179, 344, 353
SmiMI	CAYNNNNRTG	1 cut(s)	216
SphI	GCATGC	1 cut(s)	773
Sse9I	AATT	6 cut(s)	97, 165, 184, 409, 740, 1039
SsiI	CCGC	2 cut(s)	646, 908
SspMI	CTAG	1 cut(s)	876
StyD4I	CCNGG	3 cut(s)	346, 565, 990
StyI	CCWWGG	3 cut(s)	123, 211, 918
TaaI	ACNGT	2 cut(s)	494, 893
TaiI	ACGT	1 cut(s)	148
TaqI	TCGA	3 cut(s)	189, 416, 799
TasI	AATT	6 cut(s)	97, 165, 184, 409, 740, 1039
TatI	WGTACW	1 cut(s)	793
TauI	GCSGC	1 cut(s)	911
Tru1I	TTAA	4 cut(s)	84, 201, 297, 579
Tru9I	TTAA	4 cut(s)	84, 201, 297, 579
TscAI	CASTG	2 cut(s)	693, 1027
TspDTI	ATGAA	4 cut(s)	587, 775, 992, 1062
TspGWI	ACGGA	3 cut(s)	57, 503, 738
TspRI	CASTG	2 cut(s)	693, 1027
VpaK11BI	GGWCC	4 cut(s)	161, 179, 344, 353
VspI	ATTAAT	1 cut(s)	84
XapI	RAATTY	2 cut(s)	740, 1039
XbaI	TCTAGA	1 cut(s)	875
XceI	RCATGY	2 cut(s)	295, 773
XcmI	CCANNNNNNNNNTGG	3 cut(s)	121, 190, 218
XmiI	GTMKAC	1 cut(s)	51
XspI	CTAG	1 cut(s)	876
Zsp2I	ATGCAT	2 cut(s)	293, 373

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.