Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0041994.1

Orthogroup ID

OG0007057

Physical Location & Seq

Genomic Coordinates Reverse (-)

475 .. 3889

Gene Structure 3415 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0041994.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1488 bp

atggagtgctttttcaaaggtgcgaatgaggacttgacgccttctccggtagacattcttcggtgtccgtttttgaggaacattaatgagccaaccaatttttccttctcctccatgtcgtccatggctttcccgatgccggtacgtgcagccagcaaaggtccaatttttgaagatggtcccaatttcgacatggcatttaagcttttccatgggagtgatggagtagtccctctttctggacgatcatttgagcattctgagaaagttgagcatcaaccggccccatgcatgtttaatccattagctgcaaaggcagctactatcagtctctcatcctttggacctggaggacctttcggctttgatgcattctctgagaagtggaagaaaatgcaaaagaagtctaattcctcgaaaaagggttcttcttcaaagggggggaactctaatcatgaggcagcgagtaacgagtggctgcaaagtggaaactgtccgattgcaaagtcattccgtgctgttagtggtgtcattccacttgttgcaaaggctttgcagctccctccaggcatgaaagttaagtgcccaccggcaatagttgcagcacgagcagctctggcaaaaactgcatttgcaaagaacctccgcccacaacccctgcctgcaaaagttcttgtgattggagcactgggaatggcagccaatgttcctttagggatatggagagagcacaccaagaaattctctccgtcttggtttgctgctgtgcatgcagctgttccattcatagctgtacttcgaaagtctgtgttgatgcctaagtcggctatggcgtttaccattgcagcatctatattaggacaggtgattgggtctagagcagagcgctaccgtctgaaggcaaaggcggctaaaaccttggcattgactgaaacctctgttcagatcaagaagactgaaacctctgttgttgggatgaaaagccagttccaggtggttgaagcgaaatctgatcattgcactgagattgaggaatggaattcagttgctctgcagggttttggggaatcggacaccgcccctgaaaccgacgacgtcgactcgaacctccagcctttcgccggaacgccgttccgatatccaatgtcgacctcttcgctatcacctcagactttcggattgccgtggcccgatctcaacgacggcttgtcatacaacgacgtcgttaaaccctccgattccgaattgacactgatagagttctactctagcaaatacaagagctcagctccgttgcaaggttggctgcagagaatccgaaacggacagataacagttgatggagaagtagttagagattcgaatacgattctcagggttggttcggaattggtctatcataggcttgcatggagagagccggatgcgccatacttgctcgaggttctatatgaggatgatgatatggtaaatgtcttaaacctgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

495

Amino Acids

53.86

Weight (kDa)

8.7

Isoelectric Point (pI)

49.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007057)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G25030 AT4G25030
fragaria_vesca	FvH4_7g19880 FvH4_7g19880
malus_domestica	MD01G1110900.v1.1 MD05G1255700.v1.1 MD07G1177000.v1.1
prunus_persica	Prupe.2G215800_v2.0.a1
pyrus_communis	pycom01g13820 pycom07g17110
rosa_chinensis	RchiOBHm_Chr1g0363861
rosa_laevigata	RLG00000027540
rosa_multiflora	Rmu_co8207472.1_g000001 Rmu_sc0002483.1_g000002 Rmu_sc0041994.1_g000001
rosa_roxburghii	Rroxscaffold_4G00292910
rosa_rugosa	Rorug01G0310000 Rorug01G0310100 Rorug01G0310200 Rorug01G0310300
rosa_samantha	Rh1AG318400 Rh1BG281600 Rh1CG298000 Rh1DG312900
rosa_wichuraiana	Rw1G028260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	2 cut(s)	1098, 1224
AccI	GTMKAC	3 cut(s)	51, 1098, 1148
AciI	CCGC	3 cut(s)	646, 908, 1077
AcsI	RAATTY	2 cut(s)	740, 1039
AcuI	CTGAAG	1 cut(s)	917
AcyI	GRCGYC	3 cut(s)	38, 1095, 1221
AfaI	GTAC	2 cut(s)	144, 795
AfeI	AGCGCT	1 cut(s)	887
AfiI	CCNNNNNNNGG	6 cut(s)	139, 239, 898, 991, 1121, 1298
AgsI	TTSAA	4 cut(s)	16, 173, 435, 1001
AhdI	GACNNNNNGTC	1 cut(s)	1207
AjnI	CCWGG	3 cut(s)	346, 565, 990
AjuI	GAANNNNNNNTTGG	4 cut(s)	85, 89, 117, 121
AluBI	AGCT	9 cut(s)	205, 308, 320, 559, 614, 776, 791, 1284, 1289
AluI	AGCT	9 cut(s)	205, 308, 320, 559, 614, 776, 791, 1284, 1289
Alw21I	GWGCWC	3 cut(s)	688, 732, 1286
Alw26I	GTCTC	1 cut(s)	335
Ama87I	CYCGRG	1 cut(s)	1439
Aor51HI	AGCGCT	1 cut(s)	887
AoxI	GGCC	2 cut(s)	282, 1187
ApoI	RAATTY	2 cut(s)	740, 1039
AseI	ATTAAT	1 cut(s)	84
AspLEI	GCGC	2 cut(s)	888, 1429
AspS9I	GGNCC	6 cut(s)	161, 179, 283, 344, 353, 1188
AsuHPI	GGTGA	2 cut(s)	877, 1155
AsuII	TTCGAA	2 cut(s)	799, 1361
AvaI	CYCGRG	1 cut(s)	1439
AvaII	GGWCC	4 cut(s)	161, 179, 344, 353
BaeGI	GKGCMC	1 cut(s)	587
BanII	GRGCYC	1 cut(s)	1286
BarI	GAAGNNNNNNTAC	2 cut(s)	42, 74
BauI	CACGAG	1 cut(s)	606
BbsI	GAAGAC	1 cut(s)	959
Bbv12I	GWGCWC	3 cut(s)	688, 732, 1286
BccI	CCATC	3 cut(s)	170, 215, 1334
BceAI	ACGGC	3 cut(s)	1114, 1168, 1219
BciT130I	CCWGG	3 cut(s)	348, 567, 992
BclI	TGATCA	1 cut(s)	1012
BcoDI	GTCTC	1 cut(s)	335
BfaI	CTAG	2 cut(s)	876, 1269
BfmI	CTRYAG	2 cut(s)	1052, 1307
BfoI	RGCGCY	1 cut(s)	889
BlpI	GCTNAGC	1 cut(s)	1285
Bme1390I	CCNGG	3 cut(s)	348, 567, 992
Bme18I	GGWCC	4 cut(s)	161, 179, 344, 353
BmeRI	GACNNNNNGTC	1 cut(s)	1207
BmeT110I	CYCGRG	1 cut(s)	1439
BmgT120I	GGNCC	6 cut(s)	161, 179, 283, 344, 353, 1188
BmiI	GGNNCC	2 cut(s)	181, 285
BmrFI	CCNGG	3 cut(s)	348, 567, 992
BmrI	ACTGGG	1 cut(s)	698
BmsI	GCATC	6 cut(s)	126, 283, 358, 804, 857, 1414
BmuI	ACTGGG	1 cut(s)	698
BpiI	GAAGAC	1 cut(s)	959
BplI	GAGNNNNNCTC	4 cut(s)	1250, 1282, 1273, 1305
BpmI	CTGGAG	3 cut(s)	369, 549, 1094
Bpu1102I	GCTNAGC	1 cut(s)	1285
Bpu14I	TTCGAA	2 cut(s)	799, 1361
BsaAI	YACGTR	1 cut(s)	146
BsaHI	GRCGYC	3 cut(s)	38, 1095, 1221
BsaJI	CCNNGG	4 cut(s)	123, 211, 918, 1184
BsaWI	WCCGGW	1 cut(s)	46
BsaXI	ACNNNNNCTCC	4 cut(s)	28, 58, 1335, 1365
Bsc4I	CCNNNNNNNGG	6 cut(s)	139, 239, 898, 991, 1121, 1298
Bse118I	RCCGGY	3 cut(s)	139, 280, 589
Bse1I	ACTGG	2 cut(s)	693, 985
Bse3DI	GCAATG	2 cut(s)	840, 1015
BseBI	CCWGG	3 cut(s)	348, 567, 992
BseDI	CCNNGG	4 cut(s)	123, 211, 918, 1184
BseGI	GGATG	4 cut(s)	335, 981, 1429, 1462
BseLI	CCNNNNNNNGG	6 cut(s)	139, 239, 898, 991, 1121, 1298
BseMI	GCAATG	2 cut(s)	840, 1015
BseMII	CTCAG	6 cut(s)	252, 369, 1014, 1181, 1299, 1387
BseNI	ACTGG	2 cut(s)	693, 985
BseRI	GAGGAG	1 cut(s)	100
BseSI	GKGCMC	1 cut(s)	587
BsgI	GTGCAG	1 cut(s)	168
BshFI	GGCC	2 cut(s)	284, 1189
BsiHKAI	GWGCWC	3 cut(s)	688, 732, 1286
BsiHKCI	CYCGRG	1 cut(s)	1439
BsiSI	CCGG	6 cut(s)	47, 140, 281, 590, 1122, 1421
BslFI	GGGAC	2 cut(s)	165, 215
BslI	CCNNNNNNNGG	6 cut(s)	139, 239, 898, 991, 1121, 1298
BsmAI	GTCTC	1 cut(s)	335
BsmFI	GGGAC	2 cut(s)	165, 215
BsmI	GAATGC	2 cut(s)	256, 371
BsnI	GGCC	2 cut(s)	284, 1189
BsoBI	CYCGRG	1 cut(s)	1439
Bsp119I	TTCGAA	2 cut(s)	799, 1361
Bsp1286I	GDGCHC	4 cut(s)	587, 688, 732, 1286
Bsp143I	GATC	4 cut(s)	245, 945, 1012, 1192
Bsp1720I	GCTNAGC	1 cut(s)	1285
Bsp19I	CCATGG	2 cut(s)	123, 211
BspACI	CCGC	3 cut(s)	646, 908, 1077
BspANI	GGCC	2 cut(s)	284, 1189
BspCNI	CTCAG	6 cut(s)	253, 370, 1015, 1180, 1298, 1386
BspHI	TCATGA	1 cut(s)	454
BspLI	GGNNCC	2 cut(s)	181, 285
BspMAI	CTGCAG	2 cut(s)	1056, 1311
BspT104I	TTCGAA	2 cut(s)	799, 1361
BsrDI	GCAATG	2 cut(s)	840, 1015
BsrFI	RCCGGY	3 cut(s)	139, 280, 589
BsrI	ACTGG	2 cut(s)	693, 985
BssAI	RCCGGY	3 cut(s)	139, 280, 589
BssECI	CCNNGG	4 cut(s)	123, 211, 918, 1184
BssMI	GATC	4 cut(s)	245, 945, 1012, 1192
BssNI	GRCGYC	3 cut(s)	38, 1095, 1221
BssSI	CACGAG	1 cut(s)	606
BssT1I	CCWWGG	3 cut(s)	123, 211, 918
Bst2BI	CACGAG	1 cut(s)	606
Bst2UI	CCWGG	3 cut(s)	348, 567, 992
Bst4CI	ACNGT	3 cut(s)	494, 893, 1336
Bst6I	CTCTTC	1 cut(s)	1159
BstACI	GRCGYC	3 cut(s)	38, 1095, 1221
BstAPI	GCANNNNNTGC	2 cut(s)	599, 626
BstBAI	YACGTR	1 cut(s)	146
BstBI	TTCGAA	2 cut(s)	799, 1361
BstC8I	GCNNGC	4 cut(s)	154, 663, 771, 1407
BstDEI	CTNAG	7 cut(s)	261, 378, 819, 1023, 1167, 1285, 1373
BstDSI	CCRYGG	3 cut(s)	123, 211, 1184
BstF5I	GGATG	4 cut(s)	335, 981, 1429, 1462
BstH2I	RGCGCY	1 cut(s)	889
BstHHI	GCGC	2 cut(s)	888, 1429
BstKTI	GATC	4 cut(s)	248, 948, 1015, 1195
BstMAI	GTCTC	1 cut(s)	335
BstMBI	GATC	4 cut(s)	245, 945, 1012, 1192
BstNI	CCWGG	3 cut(s)	348, 567, 992
BstNSI	RCATGY	2 cut(s)	295, 773
BstSCI	CCNGG	3 cut(s)	346, 565, 990
BstSFI	CTRYAG	2 cut(s)	1052, 1307
BstSLI	GKGCMC	1 cut(s)	587
BstV2I	GAAGAC	1 cut(s)	959
BsuRI	GGCC	2 cut(s)	284, 1189
BtgI	CCRYGG	3 cut(s)	123, 211, 1184
BtsCI	GGATG	4 cut(s)	335, 981, 1429, 1462
BtsIMutI	CAGTG	3 cut(s)	686, 1020, 1250
Cac8I	GCNNGC	4 cut(s)	154, 663, 771, 1407
CciI	TCATGA	1 cut(s)	454
CfoI	GCGC	2 cut(s)	888, 1429
Cfr10I	RCCGGY	3 cut(s)	139, 280, 589
Cfr13I	GGNCC	6 cut(s)	161, 179, 283, 344, 353, 1188
CseI	GACGC	1 cut(s)	46
Csp6I	GTAC	2 cut(s)	143, 794
CviQI	GTAC	2 cut(s)	143, 794
DdeI	CTNAG	7 cut(s)	261, 378, 819, 1023, 1167, 1285, 1373
DpnI	GATC	4 cut(s)	247, 947, 1014, 1194
DpnII	GATC	4 cut(s)	245, 945, 1012, 1192
DriI	GACNNNNNGTC	1 cut(s)	1207
Eam1104I	CTCTTC	1 cut(s)	1159
Eam1105I	GACNNNNNGTC	1 cut(s)	1207
EarI	CTCTTC	1 cut(s)	1159
EciI	GGCGGA	1 cut(s)	635
Ecl136II	GAGCTC	1 cut(s)	1284
Eco130I	CCWWGG	3 cut(s)	123, 211, 918
Eco24I	GRGCYC	1 cut(s)	1286
Eco32I	GATATC	1 cut(s)	1139
Eco47I	GGWCC	4 cut(s)	161, 179, 344, 353
Eco47III	AGCGCT	1 cut(s)	887
Eco53kI	GAGCTC	1 cut(s)	1284
Eco57I	CTGAAG	1 cut(s)	917
Eco88I	CYCGRG	1 cut(s)	1439
EcoICRI	GAGCTC	1 cut(s)	1284
EcoO109I	RGGNCCY	1 cut(s)	353
EcoRI	GAATTC	1 cut(s)	1039
EcoRII	CCWGG	3 cut(s)	346, 565, 990
EcoRV	GATATC	1 cut(s)	1139
EcoT14I	CCWWGG	3 cut(s)	123, 211, 918
EcoT22I	ATGCAT	2 cut(s)	293, 373
EcoT38I	GRGCYC	1 cut(s)	1286
ErhI	CCWWGG	3 cut(s)	123, 211, 918
FaqI	GGGAC	2 cut(s)	165, 215
FbaI	TGATCA	1 cut(s)	1012
FblI	GTMKAC	3 cut(s)	51, 1098, 1148
FokI	GGATG	4 cut(s)	322, 988, 1436, 1469
FriOI	GRGCYC	1 cut(s)	1286
FspBI	CTAG	2 cut(s)	876, 1269
GlaI	GCGC	2 cut(s)	887, 1428
GsuI	CTGGAG	3 cut(s)	369, 549, 1094
HaeII	RGCGCY	1 cut(s)	889
HaeIII	GGCC	2 cut(s)	284, 1189
HapII	CCGG	6 cut(s)	47, 140, 281, 590, 1122, 1421
HgaI	GACGC	1 cut(s)	46
HhaI	GCGC	2 cut(s)	888, 1429
Hin1I	GRCGYC	3 cut(s)	38, 1095, 1221
Hin6I	GCGC	2 cut(s)	886, 1427
HinP1I	GCGC	2 cut(s)	886, 1427
HincII	GTYRAC	2 cut(s)	1099, 1149
HindII	GTYRAC	2 cut(s)	1099, 1149
HindIII	AAGCTT	1 cut(s)	203
HinfI	GANTC	6 cut(s)	1067, 1100, 1238, 1314, 1358, 1369
HpaII	CCGG	6 cut(s)	47, 140, 281, 590, 1122, 1421
HphI	GGTGA	2 cut(s)	877, 1155
Hpy166II	GTNNAC	4 cut(s)	52, 837, 1099, 1149
Hpy188III	TCNNGA	5 cut(s)	133, 240, 455, 876, 949
Hpy8I	GTNNAC	4 cut(s)	52, 837, 1099, 1149
Hpy99I	CGWCG	6 cut(s)	1094, 1097, 1100, 1205, 1223, 1226
HpyAV	CCTTC	3 cut(s)	51, 115, 892
HpyCH4III	ACNGT	3 cut(s)	494, 893, 1336
HpyCH4IV	ACGT	3 cut(s)	145, 1095, 1221
HpyF3I	CTNAG	7 cut(s)	261, 378, 819, 1023, 1167, 1285, 1373
HpySE526I	ACGT	3 cut(s)	145, 1095, 1221
Hsp92I	GRCGYC	3 cut(s)	38, 1095, 1221
HspAI	GCGC	2 cut(s)	886, 1427
Ksp22I	TGATCA	1 cut(s)	1012
Kzo9I	GATC	4 cut(s)	245, 945, 1012, 1192
LmnI	GCTCC	3 cut(s)	564, 683, 1294
LweI	GCATC	6 cut(s)	126, 283, 358, 804, 857, 1414
MaeI	CTAG	2 cut(s)	876, 1269
MaeII	ACGT	3 cut(s)	145, 1095, 1221
MaeIII	GTNAC	1 cut(s)	467
MalI	GATC	4 cut(s)	247, 947, 1014, 1194
MboI	GATC	4 cut(s)	245, 945, 1012, 1192
MboII	GAAGA	7 cut(s)	50, 185, 400, 420, 423, 964, 1146
MhlI	GDGCHC	4 cut(s)	587, 688, 732, 1286
MluCI	AATT	8 cut(s)	97, 165, 184, 409, 740, 1039, 1244, 1388
MlyI	GAGTC	1 cut(s)	1094
Mph1103I	ATGCAT	2 cut(s)	293, 373
MseI	TTAA	6 cut(s)	84, 201, 297, 579, 1227, 1478
MslI	CAYNNNNRTG	1 cut(s)	216
MspA1I	CMGCKG	1 cut(s)	776
MspI	CCGG	6 cut(s)	47, 140, 281, 590, 1122, 1421
MspR9I	CCNGG	3 cut(s)	348, 567, 992
Mva1269I	GAATGC	2 cut(s)	256, 371
MvaI	CCWGG	3 cut(s)	348, 567, 992
NcoI	CCATGG	2 cut(s)	123, 211
NdeII	GATC	4 cut(s)	245, 945, 1012, 1192
NlaIV	GGNNCC	2 cut(s)	181, 285
NsiI	ATGCAT	2 cut(s)	293, 373
NspI	RCATGY	2 cut(s)	295, 773
NspV	TTCGAA	2 cut(s)	799, 1361
PaeI	GCATGC	1 cut(s)	773
PaeR7I	CTCGAG	1 cut(s)	1439
PagI	TCATGA	1 cut(s)	454
PcsI	WCGNNNNNNNCGW	1 cut(s)	830
PctI	GAATGC	2 cut(s)	256, 371
PfeI	GAWTC	5 cut(s)	1067, 1238, 1314, 1358, 1369
PflFI	GACNNNGTC	1 cut(s)	1094
PleI	GAGTC	1 cut(s)	1094
PpsI	GAGTC	1 cut(s)	1094
Ppu21I	YACGTR	1 cut(s)	146
PpuMI	RGGWCCY	1 cut(s)	353
PshBI	ATTAAT	1 cut(s)	84
Psp124BI	GAGCTC	1 cut(s)	1286
Psp5II	RGGWCCY	1 cut(s)	353
Psp6I	CCWGG	3 cut(s)	346, 565, 990
PspGI	CCWGG	3 cut(s)	346, 565, 990
PspN4I	GGNNCC	2 cut(s)	181, 285
PspPI	GGNCC	6 cut(s)	161, 179, 283, 344, 353, 1188
PspPPI	RGGWCCY	1 cut(s)	353
PspXI	VCTCGAGB	1 cut(s)	1439
PstI	CTGCAG	2 cut(s)	1056, 1311
PsyI	GACNNNGTC	1 cut(s)	1094
PvuII	CAGCTG	1 cut(s)	776
RsaI	GTAC	2 cut(s)	144, 795
RsaNI	GTAC	2 cut(s)	143, 794
RseI	CAYNNNNRTG	1 cut(s)	216
SacI	GAGCTC	1 cut(s)	1286
SalI	GTCGAC	2 cut(s)	1097, 1147
SaqAI	TTAA	6 cut(s)	84, 201, 297, 579, 1227, 1478
Sau3AI	GATC	4 cut(s)	245, 945, 1012, 1192
Sau96I	GGNCC	6 cut(s)	161, 179, 283, 344, 353, 1188
SchI	GAGTC	1 cut(s)	1094
ScrFI	CCNGG	3 cut(s)	348, 567, 992
SduI	GDGCHC	4 cut(s)	587, 688, 732, 1286
SfaNI	GCATC	6 cut(s)	126, 283, 358, 804, 857, 1414
SfcI	CTRYAG	2 cut(s)	1052, 1307
Sfr274I	CTCGAG	1 cut(s)	1439
SfuI	TTCGAA	2 cut(s)	799, 1361
SinI	GGWCC	4 cut(s)	161, 179, 344, 353
SlaI	CTCGAG	1 cut(s)	1439
SmiMI	CAYNNNNRTG	1 cut(s)	216
SmlI	CTYRAG	1 cut(s)	1439
SmoI	CTYRAG	1 cut(s)	1439
SphI	GCATGC	1 cut(s)	773
Sse9I	AATT	8 cut(s)	97, 165, 184, 409, 740, 1039, 1244, 1388
SsiI	CCGC	3 cut(s)	646, 908, 1077
SspMI	CTAG	2 cut(s)	876, 1269
SstI	GAGCTC	1 cut(s)	1286
StyD4I	CCNGG	3 cut(s)	346, 565, 990
StyI	CCWWGG	3 cut(s)	123, 211, 918
TaaI	ACNGT	3 cut(s)	494, 893, 1336
TaiI	ACGT	3 cut(s)	148, 1098, 1224
TaqI	TCGA	8 cut(s)	189, 416, 799, 1098, 1103, 1148, 1361, 1440
TasI	AATT	8 cut(s)	97, 165, 184, 409, 740, 1039, 1244, 1388
TatI	WGTACW	1 cut(s)	793
TauI	GCSGC	1 cut(s)	911
TfiI	GAWTC	5 cut(s)	1067, 1238, 1314, 1358, 1369
Tru1I	TTAA	6 cut(s)	84, 201, 297, 579, 1227, 1478
Tru9I	TTAA	6 cut(s)	84, 201, 297, 579, 1227, 1478
TscAI	CASTG	3 cut(s)	693, 1027, 1257
TspDTI	ATGAA	3 cut(s)	587, 775, 992
TspGWI	ACGGA	5 cut(s)	57, 503, 738, 1281, 1338
TspRI	CASTG	3 cut(s)	693, 1027, 1257
Tth111I	GACNNNGTC	1 cut(s)	1094
VpaK11BI	GGWCC	4 cut(s)	161, 179, 344, 353
VspI	ATTAAT	1 cut(s)	84
XapI	RAATTY	2 cut(s)	740, 1039
XbaI	TCTAGA	1 cut(s)	875
XceI	RCATGY	2 cut(s)	295, 773
XcmI	CCANNNNNNNNNTGG	3 cut(s)	121, 190, 218
XhoI	CTCGAG	1 cut(s)	1439
XmiI	GTMKAC	3 cut(s)	51, 1098, 1148
XspI	CTAG	2 cut(s)	876, 1269
ZraI	GACGTC	2 cut(s)	1096, 1222
Zsp2I	ATGCAT	2 cut(s)	293, 373

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.