Rmu_sc0002503.1_g000015

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002503.1
OG0009948
Physical Location & Seq
Forward (+)
60169 .. 63761
3593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002503.1_g000015.1.cds

Sequence Viewer

Length: 924 bp
atgatcagagccccgtcagacaaacaagaggaattggttcgatccttcgaaaggaaccaagctcaacaaagtcgtttctggagggttttttttgcatcacttctcttctgcttcgctgcgtttcttatgtactcaatctttcagcaggtttcgtatccatgggaactgcgttatcatgcttacttcatggaggaggtgcactcatggataattatatctgcagattggctagctgtggtagcatgttcatcagcaataataggattagttcatgattcaaagcatcaccggcgatggatttggtactcattccttactggcatcatactcgcagttttctggctgtattacatgttcagattgccaagattccgctgggatgtaatctggctgccgtttggacctataagtggagctggactctgtctatatgtggatcatctgctaatggaaatctttgcaagattgtgtggtaaaacatctggtttaagacaatgccagataaagaaacgattcaggaagagggcaatattggatgagaaagatggaaatgatgatgatggggtgattgcacaggcggaaaagaaacgtgttaaaaggcggaactcgccggataaaggtgatcgtgagaatggttcagagtcagaagaagaaagactgcgtgatcaaagagagaaagagcaattggagcaaaatataaggaagagggacgcagcagccacgcggaaagtagcaaagaaaaacttgagacgaaaggaggaagaggaggctgttcgaaaaaccagtgctgatattgaaggtttaagaagagcttcgagacaacaatatctagagaaaagagtgcaaaagaaactggatgaaatcagggatgatatagaagatgaggactacttaagctcactgaagcagaataccgggagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

307

Amino Acids

36.5

Weight (kDa)

9.32

Isoelectric Point (pI)

64.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 136
AccII CGCG 1 cut(s) 724
AciI CCGC 4 cut(s) 373, 578, 601, 724
AclWI GGATC 2 cut(s) 36, 444
AcuI CTGAAG 1 cut(s) 923
AfaI GTAC 2 cut(s) 131, 305
AfiI CCNNNNNNNGG 3 cut(s) 51, 410, 617
AflII CTTAAG 1 cut(s) 892
AflIII ACRYGT 2 cut(s) 351, 589
AgsI TTSAA 2 cut(s) 279, 797
AjuI GAANNNNNNNTTGG 2 cut(s) 668, 700
AluBI AGCT 5 cut(s) 62, 233, 416, 812, 897
AluI AGCT 5 cut(s) 62, 233, 416, 812, 897
Alw21I GWGCWC 1 cut(s) 201
Alw26I GTCTC 2 cut(s) 742, 811
Alw44I GTGCAC 1 cut(s) 197
AlwI GGATC 2 cut(s) 36, 444
ApaLI GTGCAC 1 cut(s) 197
ApeKI GCWGC 4 cut(s) 116, 391, 713, 716
Asp700I GAANNNNTTC 3 cut(s) 36, 512, 811
AspS9I GGNCC 1 cut(s) 401
AsuC2I CCSGG 1 cut(s) 916
AsuHPI GGTGA 3 cut(s) 278, 577, 632
AsuII TTCGAA 2 cut(s) 48, 775
AsuNHI GCTAGC 1 cut(s) 229
AvaII GGWCC 1 cut(s) 401
BaeGI GKGCMC 1 cut(s) 201
BanII GRGCYC 1 cut(s) 13
Bbv12I GWGCWC 1 cut(s) 201
BbvI GCAGC 4 cut(s) 103, 378, 725, 728
BccI CCATC 3 cut(s) 288, 539, 554
BceAI ACGGC 1 cut(s) 379
BcgI CGANNNNNNTGC 2 cut(s) 310, 344
BciVI GTATCC 1 cut(s) 165
BclI TGATCA 2 cut(s) 3, 664
BcnI CCSGG 1 cut(s) 916
BcoDI GTCTC 2 cut(s) 742, 811
BfaI CTAG 2 cut(s) 230, 830
BfmI CTRYAG 1 cut(s) 219
BfrI CTTAAG 1 cut(s) 892
BfuAI ACCTGC 1 cut(s) 136
BfuI GTATCC 1 cut(s) 165
BisI GCNGC 4 cut(s) 117, 392, 714, 717
BlsI GCNGC 4 cut(s) 118, 393, 715, 718
Bme1390I CCNGG 1 cut(s) 916
Bme18I GGWCC 1 cut(s) 401
BmgT120I GGNCC 1 cut(s) 401
BmiI GGNNCC 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 916
BmsI GCATC 3 cut(s) 104, 292, 330
BmtI GCTAGC 1 cut(s) 233
BplI GAGNNNNNCTC 4 cut(s) 185, 217, 405, 437
BpmI CTGGAG 1 cut(s) 100
Bpu14I TTCGAA 2 cut(s) 48, 775
BpuEI CTTGAG 1 cut(s) 766
BpuMI CCSGG 1 cut(s) 916
BsaJI CCNNGG 1 cut(s) 158
Bsc4I CCNNNNNNNGG 3 cut(s) 51, 410, 617
Bse118I RCCGGY 1 cut(s) 288
Bse1I ACTGG 3 cut(s) 322, 783, 858
BseDI CCNNGG 1 cut(s) 158
BseGI GGATG 4 cut(s) 385, 541, 862, 874
BseLI CCNNNNNNNGG 3 cut(s) 51, 410, 617
BseNI ACTGG 3 cut(s) 322, 783, 858
BseRI GAGGAG 2 cut(s) 206, 779
BseSI GKGCMC 1 cut(s) 201
BseXI GCAGC 4 cut(s) 103, 378, 725, 728
BseYI CCCAGC 1 cut(s) 375
Bsh1236I CGCG 1 cut(s) 724
BsiHKAI GWGCWC 1 cut(s) 201
BsiSI CCGG 3 cut(s) 289, 611, 915
BslFI GGGAC 1 cut(s) 722
BslI CCNNNNNNNGG 3 cut(s) 51, 410, 617
BsmAI GTCTC 2 cut(s) 742, 811
BsmBI CGTCTC 1 cut(s) 742
BsmFI GGGAC 1 cut(s) 722
Bsp119I TTCGAA 2 cut(s) 48, 775
Bsp1286I GDGCHC 2 cut(s) 13, 201
Bsp143I GATC 5 cut(s) 3, 41, 436, 622, 664
Bsp19I CCATGG 1 cut(s) 158
BspACI CCGC 4 cut(s) 373, 578, 601, 724
BspFNI CGCG 1 cut(s) 724
BspHI TCATGA 1 cut(s) 271
BspLI GGNNCC 1 cut(s) 56
BspMAI CTGCAG 1 cut(s) 223
BspMI ACCTGC 1 cut(s) 136
BspOI GCTAGC 1 cut(s) 233
BspPI GGATC 2 cut(s) 36, 444
BspQI GCTCTTC 1 cut(s) 802
BspT104I TTCGAA 2 cut(s) 48, 775
BspTI CTTAAG 1 cut(s) 892
BsrFI RCCGGY 1 cut(s) 288
BsrI ACTGG 3 cut(s) 322, 783, 858
BssAI RCCGGY 1 cut(s) 288
BssECI CCNNGG 1 cut(s) 158
BssMI GATC 5 cut(s) 3, 41, 436, 622, 664
BssT1I CCWWGG 1 cut(s) 158
Bst6I CTCTTC 5 cut(s) 110, 515, 698, 756, 802
BstAFI CTTAAG 1 cut(s) 892
BstBI TTCGAA 2 cut(s) 48, 775
BstC8I GCNNGC 1 cut(s) 231
BstDSI CCRYGG 1 cut(s) 158
BstENI CCTNNNNNAGG 1 cut(s) 49
BstF5I GGATG 4 cut(s) 385, 541, 862, 874
BstFNI CGCG 1 cut(s) 724
BstKTI GATC 5 cut(s) 6, 44, 439, 625, 667
BstMAI GTCTC 2 cut(s) 742, 811
BstMBI GATC 5 cut(s) 3, 41, 436, 622, 664
BstMWI GCNNNNNNNGC 4 cut(s) 239, 289, 607, 688
BstNSI RCATGY 2 cut(s) 246, 355
BstSCI CCNGG 1 cut(s) 914
BstSFI CTRYAG 1 cut(s) 219
BstSLI GKGCMC 1 cut(s) 201
BstUI CGCG 1 cut(s) 724
BstV1I GCAGC 4 cut(s) 103, 378, 725, 728
BsuI GTATCC 1 cut(s) 165
BtgI CCRYGG 1 cut(s) 158
BtgZI GCGATG 1 cut(s) 307
BtsCI GGATG 4 cut(s) 385, 541, 862, 874
BtsIMutI CAGTG 2 cut(s) 790, 899
BveI ACCTGC 1 cut(s) 136
Cac8I GCNNGC 1 cut(s) 231
CciI TCATGA 1 cut(s) 271
Cfr10I RCCGGY 1 cut(s) 288
Cfr13I GGNCC 1 cut(s) 401
CseI GACGC 1 cut(s) 719
Csp6I GTAC 2 cut(s) 130, 304
CviAII CATG 7 cut(s) 159, 176, 187, 204, 243, 272, 352
CviQI GTAC 2 cut(s) 130, 304
DpnI GATC 5 cut(s) 5, 43, 438, 624, 666
DpnII GATC 5 cut(s) 3, 41, 436, 622, 664
Eam1104I CTCTTC 5 cut(s) 110, 515, 698, 756, 802
EarI CTCTTC 5 cut(s) 110, 515, 698, 756, 802
EciI GGCGGA 2 cut(s) 593, 616
Eco130I CCWWGG 1 cut(s) 158
Eco24I GRGCYC 1 cut(s) 13
Eco47I GGWCC 1 cut(s) 401
Eco57I CTGAAG 1 cut(s) 923
EcoNI CCTNNNNNAGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 158
EcoT38I GRGCYC 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 158
Esp3I CGTCTC 1 cut(s) 742
FaeI CATG 7 cut(s) 162, 179, 190, 207, 246, 275, 355
FalI AAGNNNNNCTT 4 cut(s) 728, 760, 796, 828
FaqI GGGAC 1 cut(s) 722
FatI CATG 7 cut(s) 158, 175, 186, 203, 242, 271, 351
FbaI TGATCA 2 cut(s) 3, 664
Fnu4HI GCNGC 4 cut(s) 117, 392, 714, 717
FokI GGATG 4 cut(s) 392, 548, 869, 881
FriOI GRGCYC 1 cut(s) 13
Fsp4HI GCNGC 4 cut(s) 117, 392, 714, 717
FspBI CTAG 2 cut(s) 230, 830
GluI GCNGC 4 cut(s) 117, 392, 714, 717
GsaI CCCAGC 1 cut(s) 379
GsuI CTGGAG 1 cut(s) 100
HapII CCGG 3 cut(s) 289, 611, 915
HgaI GACGC 1 cut(s) 719
Hin1II CATG 7 cut(s) 162, 179, 190, 207, 246, 275, 355
HinfI GANTC 5 cut(s) 275, 369, 420, 513, 641
HpaII CCGG 3 cut(s) 289, 611, 915
HphI GGTGA 3 cut(s) 278, 577, 632
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 5 cut(s) 8, 19, 359, 640, 646
Hpy188III TCNNGA 6 cut(s) 79, 272, 517, 626, 816, 830
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 2 cut(s) 55, 791
HpyCH4IV ACGT 1 cut(s) 589
HpyCH4V TGCA 6 cut(s) 95, 199, 221, 461, 572, 844
HpyF10VI GCNNNNNNNGC 4 cut(s) 239, 289, 607, 688
HpySE526I ACGT 1 cut(s) 589
Hsp92II CATG 7 cut(s) 162, 179, 190, 207, 246, 275, 355
Ksp22I TGATCA 2 cut(s) 3, 664
Kzo9I GATC 5 cut(s) 3, 41, 436, 622, 664
LguI GCTCTTC 1 cut(s) 802
LmnI GCTCC 2 cut(s) 413, 688
Lsp1109I GCAGC 4 cut(s) 103, 378, 725, 728
LweI GCATC 3 cut(s) 104, 292, 330
MaeI CTAG 2 cut(s) 230, 830
MaeII ACGT 1 cut(s) 589
MalI GATC 5 cut(s) 5, 43, 438, 624, 666
MboI GATC 5 cut(s) 3, 41, 436, 622, 664
MboII GAAGA 8 cut(s) 97, 532, 659, 662, 715, 773, 819, 890
MfeI CAATTG 1 cut(s) 683
MhlI GDGCHC 2 cut(s) 13, 201
MluCI AATT 3 cut(s) 32, 210, 683
MlyI GAGTC 2 cut(s) 414, 650
MroXI GAANNNNTTC 3 cut(s) 36, 512, 811
MseI TTAA 4 cut(s) 488, 594, 803, 893
MspA1I CMGCKG 1 cut(s) 375
MspCI CTTAAG 1 cut(s) 892
MspI CCGG 3 cut(s) 289, 611, 915
MspR9I CCNGG 1 cut(s) 916
MunI CAATTG 1 cut(s) 683
MvnI CGCG 1 cut(s) 724
MwoI GCNNNNNNNGC 4 cut(s) 239, 289, 607, 688
NciI CCSGG 1 cut(s) 916
NcoI CCATGG 1 cut(s) 158
NdeII GATC 5 cut(s) 3, 41, 436, 622, 664
NheI GCTAGC 1 cut(s) 229
NlaIII CATG 7 cut(s) 162, 179, 190, 207, 246, 275, 355
NlaIV GGNNCC 1 cut(s) 56
NspI RCATGY 2 cut(s) 246, 355
NspV TTCGAA 2 cut(s) 48, 775
PagI TCATGA 1 cut(s) 271
PciI ACATGT 1 cut(s) 351
PciSI GCTCTTC 1 cut(s) 802
PdmI GAANNNNTTC 3 cut(s) 36, 512, 811
PfeI GAWTC 3 cut(s) 275, 369, 513
PflFI GACNNNGTC 1 cut(s) 423
PkrI GCNGC 4 cut(s) 118, 393, 715, 718
PleI GAGTC 2 cut(s) 414, 649
PpsI GAGTC 2 cut(s) 414, 649
PscI ACATGT 1 cut(s) 351
PspFI CCCAGC 1 cut(s) 375
PspN4I GGNNCC 1 cut(s) 56
PspPI GGNCC 1 cut(s) 401
PsrI GAACNNNNNNTAC 2 cut(s) 338, 370
PstI CTGCAG 1 cut(s) 223
PsyI GACNNNGTC 1 cut(s) 423
RsaI GTAC 2 cut(s) 131, 305
RsaNI GTAC 2 cut(s) 130, 304
SapI GCTCTTC 1 cut(s) 802
SaqAI TTAA 4 cut(s) 488, 594, 803, 893
SatI GCNGC 4 cut(s) 117, 392, 714, 717
Sau3AI GATC 5 cut(s) 3, 41, 436, 622, 664
Sau96I GGNCC 1 cut(s) 401
SchI GAGTC 2 cut(s) 414, 650
ScrFI CCNGG 1 cut(s) 916
SduI GDGCHC 2 cut(s) 13, 201
SfaNI GCATC 3 cut(s) 104, 292, 330
SfcI CTRYAG 1 cut(s) 219
SfuI TTCGAA 2 cut(s) 48, 775
SgrAI CRCCGGYG 1 cut(s) 288
SinI GGWCC 1 cut(s) 401
SmlI CTYRAG 2 cut(s) 745, 892
SmoI CTYRAG 2 cut(s) 745, 892
Sse9I AATT 3 cut(s) 32, 210, 683
SsiI CCGC 4 cut(s) 373, 578, 601, 724
SspI AATATT 1 cut(s) 531
SspMI CTAG 2 cut(s) 230, 830
StyD4I CCNGG 1 cut(s) 914
StyI CCWWGG 1 cut(s) 158
TaiI ACGT 1 cut(s) 592
TaqI TCGA 4 cut(s) 40, 48, 775, 815
TasI AATT 3 cut(s) 32, 210, 683
TatI WGTACW 1 cut(s) 129
TfiI GAWTC 3 cut(s) 275, 369, 513
Tru1I TTAA 4 cut(s) 488, 594, 803, 893
Tru9I TTAA 4 cut(s) 488, 594, 803, 893
TscAI CASTG 2 cut(s) 790, 906
TseI GCWGC 4 cut(s) 116, 391, 713, 716
TspDTI ATGAA 4 cut(s) 175, 237, 260, 873
TspRI CASTG 2 cut(s) 790, 906
Tth111I GACNNNGTC 1 cut(s) 423
Vha464I CTTAAG 1 cut(s) 892
VneI GTGCAC 1 cut(s) 197
VpaK11BI GGWCC 1 cut(s) 401
XagI CCTNNNNNAGG 1 cut(s) 49
XbaI TCTAGA 1 cut(s) 829
XceI RCATGY 2 cut(s) 246, 355
XcmI CCANNNNNNNNNTGG 1 cut(s) 372
XmnI GAANNNNTTC 3 cut(s) 36, 512, 811
XspI CTAG 2 cut(s) 230, 830
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.