Rmu_sc0002662.1_g000010

F-box WD-40 repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002662.1
OG0004801
Physical Location & Seq
Forward (+)
46601 .. 50550
3950 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 984 bp
atgggtttgcttcttactggcattggtgataaggttatgcgcctttggtcattggaaagctataaatgtgtgggagaatatcccattccagacaaagtccctttagttgactttgattttgatgagagcaagattgttggtttggtcggcagtcgtatatgcatatggaggcggaatgggataagaagtatatttccctcgcgtgagggcacctttccaaagggcttatgcatgcgttactgcgatccggatgctgtggttggctgtgtggatgggacagctcgtgtatttgacatgtacagtcaacaatgttctcaaatcgttaaaatgcatgctggtccagtgacatgcttatgtttgagtgatgatcagttgatacttagcggttcttctcttggcagtatcacggtgtccagacttttatctgatcagctggttgcagaattaagatcgacacattccacagacataaggactttgtgttacaacccctcatctcaccggctgttcgctggatcaactgatggatatgtattttgttgggaccttaggacaaggagatgtttatgggagacacgagtgagtccaaatgtggtatattcaatgcaacacctgagaaatgatgcatcaagcttggtggttggtggaatagatggtgtgctacgtatactgaatcagaacacagttggaagtggcacagtccaaagaatgacaggacgaaggctttcacaaaatgcctcaattgatagcattcctagaagcagtcgacctcccatcacttgcttagtggtcgggatgaagaaggttatcaccacacacaataataacttgaaatcaagcacctggagcaaaactccagtctcagagaaagatggtttaccagtttggtacttcacaacacctggggttaagcaggatgttcattttcttgctttccaacaccaggcattcttgattagatgcccaatatgcaatctgttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04120 map04120
Pfam Domains
Protein Families
F-box F-box-like WD40

Protein Analysis

327

Amino Acids

36.39

Weight (kDa)

8.93

Isoelectric Point (pI)

42.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Beta-prop_EML PF23409 10 - 176 8.8e-07 Echinoderm microtubule-associated protein first beta-propeller
Beta-prop_HPS5 PF23756 73 - 196 1.5e-06 HPS5 beta-propeller
Beta-prop_EML_2 PF23414 75 - 176 2.3e-06 Echinoderm microtubule-associated protein second beta-propeller
WD40_WDHD1_1st PF24817 76 - 199 7.8e-11 WDHD1 first WD40 domain
Beta-prop_ACSF4 PF13570 76 - 227 7.1e-10 Beta-alanine-activating enzyme, beta-propeller
WD40_Prp19 PF24814 77 - 227 1.2e-10 Prp19 WD40 domain
WD40_Gbeta PF25391 77 - 189 2e-06 G protein beta WD-40 repeat protein
Beta-prop_WDR3_1st PF25173 85 - 223 6.4e-18 WDR3 first beta-propeller domain
WD40_CDC20-Fz PF24807 86 - 228 1.8e-12 CDC20/Fizzy WD40 domain
Beta-prop_WDR36-Utp21_1st PF25171 86 - 193 3e-06 WDR36/Utp21 first beta-propeller
Beta-prop_WDR5 PF25175 89 - 228 1.9e-14 WDR5 beta-propeller domain
Beta-prop_WDR90_POC16_2nd PF23393 90 - 209 3.1e-06 WDR90/POC16, second beta-propeller
Beta-prop_THOC3 PF25174 124 - 229 1.5e-08 THOC3 beta-propeller domain
WDR55 PF24796 126 - 226 2.2e-07 WDR55
Beta-prop_EML_2 PF23414 159 - 231 2.4e-07 Echinoderm microtubule-associated protein second beta-propeller
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 209
AccI GTMKAC 2 cut(s) 667, 766
AccII CGCG 1 cut(s) 202
AccIII TCCGGA 1 cut(s) 247
AciI CCGC 2 cut(s) 172, 384
AclWI GGATC 2 cut(s) 239, 523
AfaI GTAC 2 cut(s) 299, 890
AfiI CCNNNNNNNGG 1 cut(s) 943
AflIII ACRYGT 1 cut(s) 294
AgsI TTSAA 2 cut(s) 603, 832
AjnI CCWGG 3 cut(s) 842, 901, 942
AluBI AGCT 4 cut(s) 60, 281, 433, 633
AluI AGCT 4 cut(s) 60, 281, 433, 633
Alw26I GTCTC 2 cut(s) 566, 865
AlwI GGATC 2 cut(s) 239, 523
Aor13HI TCCGGA 1 cut(s) 247
ArsI GACNNNNNNTTYG 4 cut(s) 101, 133, 843, 875
Asp700I GAANNNNTTC 1 cut(s) 724
AspLEI GCGC 1 cut(s) 42
AspS9I GGNCC 2 cut(s) 338, 544
AsuHPI GGTGA 3 cut(s) 38, 491, 802
AvaII GGWCC 2 cut(s) 338, 544
AxyI CCTNAGG 1 cut(s) 548
BaeGI GKGCMC 1 cut(s) 212
BanI GGYRCC 1 cut(s) 209
BauI CACGAG 2 cut(s) 282, 576
BccI CCATC 5 cut(s) 266, 518, 647, 782, 866
BcgI CGANNNNNNTGC 2 cut(s) 233, 267
BciT130I CCWGG 3 cut(s) 844, 903, 944
BclI TGATCA 2 cut(s) 367, 427
BcoDI GTCTC 2 cut(s) 566, 865
BfaI CTAG 1 cut(s) 756
Bme1390I CCNGG 3 cut(s) 844, 903, 944
Bme18I GGWCC 2 cut(s) 338, 544
BmgT120I GGNCC 2 cut(s) 338, 544
BmiI GGNNCC 2 cut(s) 211, 545
BmrFI CCNGG 3 cut(s) 844, 903, 944
BmsI GCATC 4 cut(s) 241, 613, 635, 950
BplI GAGNNNNNCTC 2 cut(s) 838, 870
BpmI CTGGAG 2 cut(s) 840, 865
BsaAI YACGTR 1 cut(s) 665
BsaJI CCNNGG 1 cut(s) 902
BsaWI WCCGGW 1 cut(s) 247
Bsc4I CCNNNNNNNGG 1 cut(s) 943
Bse118I RCCGGY 1 cut(s) 501
Bse1I ACTGG 4 cut(s) 22, 341, 857, 881
Bse21I CCTNAGG 1 cut(s) 548
BseAI TCCGGA 1 cut(s) 247
BseBI CCWGG 3 cut(s) 844, 903, 944
BseDI CCNNGG 1 cut(s) 902
BseGI GGATG 4 cut(s) 256, 277, 801, 922
BseLI CCNNNNNNNGG 1 cut(s) 943
BseMII CTCAG 2 cut(s) 605, 876
BseNI ACTGG 4 cut(s) 22, 341, 857, 881
BseSI GKGCMC 1 cut(s) 212
Bsh1236I CGCG 1 cut(s) 202
BshNI GGYRCC 1 cut(s) 209
BsiSI CCGG 2 cut(s) 248, 502
BslFI GGGAC 3 cut(s) 83, 289, 557
BslI CCNNNNNNNGG 1 cut(s) 943
BsmAI GTCTC 2 cut(s) 566, 865
BsmFI GGGAC 3 cut(s) 83, 289, 557
BsmI GAATGC 2 cut(s) 750, 947
Bsp1286I GDGCHC 1 cut(s) 212
Bsp13I TCCGGA 1 cut(s) 247
Bsp1407I TGTACA 1 cut(s) 297
Bsp143I GATC 5 cut(s) 244, 367, 427, 449, 515
BspACI CCGC 2 cut(s) 172, 384
BspCNI CTCAG 2 cut(s) 606, 875
BspEI TCCGGA 1 cut(s) 247
BspFNI CGCG 1 cut(s) 202
BspLI GGNNCC 2 cut(s) 211, 545
BspPI GGATC 2 cut(s) 239, 523
BspT107I GGYRCC 1 cut(s) 209
BsrFI RCCGGY 1 cut(s) 501
BsrGI TGTACA 1 cut(s) 297
BsrI ACTGG 4 cut(s) 22, 341, 857, 881
BssAI RCCGGY 1 cut(s) 501
BssECI CCNNGG 1 cut(s) 902
BssMI GATC 5 cut(s) 244, 367, 427, 449, 515
BssNAI GTATAC 1 cut(s) 668
BssSI CACGAG 2 cut(s) 282, 576
Bst1107I GTATAC 1 cut(s) 668
Bst2BI CACGAG 2 cut(s) 282, 576
Bst2UI CCWGG 3 cut(s) 844, 903, 944
Bst4CI ACNGT 4 cut(s) 302, 409, 685, 700
BstAUI TGTACA 1 cut(s) 297
BstBAI YACGTR 1 cut(s) 665
BstC8I GCNNGC 2 cut(s) 233, 333
BstDEI CTNAG 5 cut(s) 380, 548, 614, 784, 862
BstF5I GGATG 4 cut(s) 256, 277, 801, 922
BstFNI CGCG 1 cut(s) 202
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 5 cut(s) 247, 370, 430, 452, 518
BstMAI GTCTC 2 cut(s) 566, 865
BstMBI GATC 5 cut(s) 244, 367, 427, 449, 515
BstMWI GCNNNNNNNGC 2 cut(s) 846, 969
BstNI CCWGG 3 cut(s) 844, 903, 944
BstNSI RCATGY 4 cut(s) 235, 298, 335, 351
BstSCI CCNGG 3 cut(s) 842, 901, 942
BstSLI GKGCMC 1 cut(s) 212
BstSNI TACGTA 1 cut(s) 665
BstUI CGCG 1 cut(s) 202
BstZ17I GTATAC 1 cut(s) 668
Bsu36I CCTNAGG 1 cut(s) 548
BtsCI GGATG 4 cut(s) 256, 277, 801, 922
BtsIMutI CAGTG 1 cut(s) 348
Cac8I GCNNGC 2 cut(s) 233, 333
CfoI GCGC 1 cut(s) 42
Cfr10I RCCGGY 1 cut(s) 501
Cfr13I GGNCC 2 cut(s) 338, 544
Csp6I GTAC 2 cut(s) 298, 889
CspCI CAANNNNNGTGG 2 cut(s) 618, 653
CviAII CATG 4 cut(s) 232, 295, 332, 348
CviJI RGCY 8 cut(s) 60, 225, 264, 281, 433, 505, 633, 724
CviKI_1 RGCY 8 cut(s) 60, 225, 264, 281, 433, 505, 633, 724
CviQI GTAC 2 cut(s) 298, 889
DdeI CTNAG 5 cut(s) 380, 548, 614, 784, 862
DpnI GATC 5 cut(s) 246, 369, 429, 451, 517
DpnII GATC 5 cut(s) 244, 367, 427, 449, 515
EciI GGCGGA 1 cut(s) 187
Eco105I TACGTA 1 cut(s) 665
Eco47I GGWCC 2 cut(s) 338, 544
Eco81I CCTNAGG 1 cut(s) 548
EcoO109I RGGNCCY 1 cut(s) 544
EcoRII CCWGG 3 cut(s) 842, 901, 942
EcoT22I ATGCAT 4 cut(s) 164, 233, 333, 628
FaeI CATG 4 cut(s) 235, 298, 335, 351
FaqI GGGAC 3 cut(s) 83, 289, 557
FatI CATG 4 cut(s) 231, 294, 331, 347
FauNDI CATATG 1 cut(s) 164
FbaI TGATCA 2 cut(s) 367, 427
FblI GTMKAC 2 cut(s) 667, 766
FokI GGATG 4 cut(s) 263, 284, 808, 929
FspBI CTAG 1 cut(s) 756
GlaI GCGC 1 cut(s) 41
GsuI CTGGAG 2 cut(s) 840, 865
HapII CCGG 2 cut(s) 248, 502
HhaI GCGC 1 cut(s) 42
Hin1II CATG 4 cut(s) 235, 298, 335, 351
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HincII GTYRAC 3 cut(s) 109, 305, 767
HindII GTYRAC 3 cut(s) 109, 305, 767
HindIII AAGCTT 1 cut(s) 631
HinfI GANTC 2 cut(s) 583, 673
HpaII CCGG 2 cut(s) 248, 502
HphI GGTGA 3 cut(s) 38, 491, 802
Hpy166II GTNNAC 5 cut(s) 109, 305, 668, 767, 878
Hpy188I TCNGA 3 cut(s) 427, 678, 865
Hpy188III TCNNGA 5 cut(s) 89, 248, 414, 793, 952
Hpy8I GTNNAC 5 cut(s) 109, 305, 668, 767, 878
HpyAV CCTTC 2 cut(s) 714, 796
HpyCH4III ACNGT 4 cut(s) 302, 409, 685, 700
HpyCH4IV ACGT 1 cut(s) 664
HpyCH4V TGCA 7 cut(s) 162, 231, 331, 440, 607, 626, 972
HpyF10VI GCNNNNNNNGC 2 cut(s) 846, 969
HpyF3I CTNAG 5 cut(s) 380, 548, 614, 784, 862
HpySE526I ACGT 1 cut(s) 664
Hsp92II CATG 4 cut(s) 235, 298, 335, 351
HspAI GCGC 1 cut(s) 40
Kpn2I TCCGGA 1 cut(s) 247
Ksp22I TGATCA 2 cut(s) 367, 427
Kzo9I GATC 5 cut(s) 244, 367, 427, 449, 515
LmnI GCTCC 1 cut(s) 846
LweI GCATC 4 cut(s) 241, 613, 635, 950
MaeI CTAG 1 cut(s) 756
MaeII ACGT 1 cut(s) 664
MaeIII GTNAC 3 cut(s) 236, 343, 482
MalI GATC 5 cut(s) 246, 369, 429, 451, 517
MboI GATC 5 cut(s) 244, 367, 427, 449, 515
MboII GAAGA 2 cut(s) 381, 811
MfeI CAATTG 1 cut(s) 741
MhlI GDGCHC 1 cut(s) 212
MluCI AATT 2 cut(s) 443, 741
MlyI GAGTC 1 cut(s) 592
MmeI TCCRAC 2 cut(s) 667, 961
MnlI CCTC 6 cut(s) 162, 199, 208, 502, 748, 780
Mph1103I ATGCAT 4 cut(s) 164, 233, 333, 628
MroI TCCGGA 1 cut(s) 247
MroXI GAANNNNTTC 1 cut(s) 724
MseI TTAA 3 cut(s) 324, 446, 909
MslI CAYNNNNRTG 1 cut(s) 352
MspA1I CMGCKG 1 cut(s) 433
MspI CCGG 2 cut(s) 248, 502
MspR9I CCNGG 3 cut(s) 844, 903, 944
MunI CAATTG 1 cut(s) 741
Mva1269I GAATGC 2 cut(s) 750, 947
MvaI CCWGG 3 cut(s) 844, 903, 944
MvnI CGCG 1 cut(s) 202
MwoI GCNNNNNNNGC 2 cut(s) 846, 969
NdeI CATATG 1 cut(s) 164
NdeII GATC 5 cut(s) 244, 367, 427, 449, 515
NlaIII CATG 4 cut(s) 235, 298, 335, 351
NlaIV GGNNCC 2 cut(s) 211, 545
NmuCI GTSAC 1 cut(s) 343
NsiI ATGCAT 4 cut(s) 164, 233, 333, 628
NspI RCATGY 4 cut(s) 235, 298, 335, 351
PaeI GCATGC 2 cut(s) 235, 335
PciI ACATGT 1 cut(s) 294
PctI GAATGC 2 cut(s) 750, 947
PdmI GAANNNNTTC 1 cut(s) 724
PfeI GAWTC 1 cut(s) 673
PflFI GACNNNGTC 1 cut(s) 95
PleI GAGTC 1 cut(s) 591
PpsI GAGTC 1 cut(s) 591
Ppu21I YACGTR 1 cut(s) 665
PpuMI RGGWCCY 1 cut(s) 544
PscI ACATGT 1 cut(s) 294
Psp5II RGGWCCY 1 cut(s) 544
Psp6I CCWGG 3 cut(s) 842, 901, 942
PspGI CCWGG 3 cut(s) 842, 901, 942
PspN4I GGNNCC 2 cut(s) 211, 545
PspPI GGNCC 2 cut(s) 338, 544
PspPPI RGGWCCY 1 cut(s) 544
PsyI GACNNNGTC 1 cut(s) 95
PvuII CAGCTG 1 cut(s) 433
RsaI GTAC 2 cut(s) 299, 890
RsaNI GTAC 2 cut(s) 298, 889
RseI CAYNNNNRTG 1 cut(s) 352
SalI GTCGAC 1 cut(s) 765
SaqAI TTAA 3 cut(s) 324, 446, 909
Sau3AI GATC 5 cut(s) 244, 367, 427, 449, 515
Sau96I GGNCC 2 cut(s) 338, 544
SchI GAGTC 1 cut(s) 592
ScrFI CCNGG 3 cut(s) 844, 903, 944
SduI GDGCHC 1 cut(s) 212
SfaNI GCATC 4 cut(s) 241, 613, 635, 950
SinI GGWCC 2 cut(s) 338, 544
SmiMI CAYNNNNRTG 1 cut(s) 352
SnaBI TACGTA 1 cut(s) 665
SphI GCATGC 2 cut(s) 235, 335
Sse9I AATT 2 cut(s) 443, 741
SsiI CCGC 2 cut(s) 172, 384
SspMI CTAG 1 cut(s) 756
StyD4I CCNGG 3 cut(s) 842, 901, 942
TaaI ACNGT 4 cut(s) 302, 409, 685, 700
TaiI ACGT 1 cut(s) 667
TaqI TCGA 2 cut(s) 452, 766
TasI AATT 2 cut(s) 443, 741
TatI WGTACW 1 cut(s) 297
TfiI GAWTC 1 cut(s) 673
Tru1I TTAA 3 cut(s) 324, 446, 909
Tru9I TTAA 3 cut(s) 324, 446, 909
TscAI CASTG 1 cut(s) 348
TseFI GTSAC 1 cut(s) 343
Tsp45I GTSAC 1 cut(s) 343
TspDTI ATGAA 2 cut(s) 812, 911
TspRI CASTG 1 cut(s) 348
Tth111I GACNNNGTC 1 cut(s) 95
VpaK11BI GGWCC 2 cut(s) 338, 544
XceI RCATGY 4 cut(s) 235, 298, 335, 351
XmiI GTMKAC 2 cut(s) 667, 766
XmnI GAANNNNTTC 1 cut(s) 724
XspI CTAG 1 cut(s) 756
Zsp2I ATGCAT 4 cut(s) 164, 233, 333, 628
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.