Rmu_sc0003177.1_g000006

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003177.1
OG0009944
Physical Location & Seq
Forward (+)
28270 .. 29621
1352 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 951 bp
atgatcttattttcattgagtttggttgtgaatgcccaattgagtacggatttctaccagcaaacatgtccaaatcttctcaaaatcgtccggaaagaagttcagaatgctatcaaatccgaaatgcgaatggctgcttctttgcttcggctgcacttccacgactgctttgtcaacggttgtgatgcgtcggtactactcgacttacctgatggcgagaaggctgcctttccgaacttgaattcggcaagagggtttgaagttatcgatgcaatcaagagctccgtggagagtgcatgtagtggagttgtttcttgtgctgatatacttaccatagctgcccgagattctgtggtcttaagtggaggaaattcatggaaagttttgctgggaagaagagacgggtttgtggcaaaccagacaggagcaaacgttgggcttccttctccatttgacacgcttgatgccatcatttccaagttcgccaatgtaggcctaaatgtcacagacgtggtagccttatcaggagctcatacaattgggttagcaaggtgtgcaactttcagcaacagattgttcaacttccaaggaacaggtggtccagacagcacgttagattcaagtatggcaactgatctacagaacctatgccctgtgaccagcgacggaaacaacactgcggctcttgataggaactctagagatttattcgacaaccattactttcagaacttgctcaccggaaagggccttctcagttctgatcagcttttaatttctagtgatttagccgatacaacaagtaccaagagcttggtccaaagctatagctctaatcccaaccttttcctggcagattttgctaattctatgatcaaaatgggaagtataagtccactcaccgggtcttctggagagataagaaagaactgcagggttgttaattcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
peroxidase

Protein Analysis

316

Amino Acids

33.63

Weight (kDa)

5.35

Isoelectric Point (pI)

29.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 30 - 279 8.1e-84 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AccIII TCCGGA 1 cut(s) 90
AciI CCGC 1 cut(s) 680
AclI AACGTT 1 cut(s) 432
AcsI RAATTY 2 cut(s) 241, 370
AfaI GTAC 3 cut(s) 46, 195, 805
AfiI CCNNNNNNNGG 2 cut(s) 850, 902
AflII CTTAAG 1 cut(s) 358
AflIII ACRYGT 1 cut(s) 65
AgsI TTSAA 4 cut(s) 241, 260, 580, 621
AjiI CACGTC 1 cut(s) 511
AjnI CCWGG 1 cut(s) 849
AleI CACNNNNGTG 1 cut(s) 509
AloI GAACNNNNNNTCC 2 cut(s) 583, 615
AluBI AGCT 7 cut(s) 282, 338, 530, 769, 813, 825, 831
AluI AGCT 7 cut(s) 282, 338, 530, 769, 813, 825, 831
Alw21I GWGCWC 2 cut(s) 284, 532
Alw26I GTCTC 1 cut(s) 393
Ama87I CYCGRG 1 cut(s) 342
Aor13HI TCCGGA 1 cut(s) 90
AoxI GGCC 2 cut(s) 493, 748
ApeKI GCWGC 4 cut(s) 134, 151, 224, 338
ApoI RAATTY 2 cut(s) 241, 370
AspS9I GGNCC 3 cut(s) 599, 748, 817
AsuC2I CCSGG 1 cut(s) 904
AsuHPI GGTGA 2 cut(s) 730, 892
AvaI CYCGRG 1 cut(s) 342
AvaII GGWCC 2 cut(s) 599, 817
BanII GRGCYC 2 cut(s) 284, 532
BbsI GAAGAC 1 cut(s) 900
Bbv12I GWGCWC 2 cut(s) 284, 532
BbvI GCAGC 4 cut(s) 121, 138, 211, 325
BccI CCATC 2 cut(s) 206, 476
BcgI CGANNNNNNTGC 2 cut(s) 206, 240
BciT130I CCWGG 1 cut(s) 851
BclI TGATCA 2 cut(s) 763, 873
BcnI CCSGG 1 cut(s) 904
BcoDI GTCTC 1 cut(s) 393
BfaI CTAG 2 cut(s) 699, 780
BfmI CTRYAG 3 cut(s) 638, 826, 931
BfrI CTTAAG 1 cut(s) 358
BisI GCNGC 5 cut(s) 135, 152, 225, 339, 681
BlsI GCNGC 5 cut(s) 136, 153, 226, 340, 682
Bme1390I CCNGG 2 cut(s) 851, 904
Bme18I GGWCC 2 cut(s) 599, 817
BmeT110I CYCGRG 1 cut(s) 342
BmgBI CACGTC 1 cut(s) 511
BmgT120I GGNCC 3 cut(s) 599, 748, 817
BmrFI CCNGG 2 cut(s) 851, 904
BmsI GCATC 3 cut(s) 175, 259, 454
BpiI GAAGAC 1 cut(s) 900
BpmI CTGGAG 1 cut(s) 933
BpuMI CCSGG 1 cut(s) 904
Bsa29I ATCGAT 1 cut(s) 267
BsaJI CCNNGG 2 cut(s) 285, 586
BsaWI WCCGGW 2 cut(s) 90, 740
BsaXI ACNNNNNCTCC 2 cut(s) 417, 447
Bsc4I CCNNNNNNNGG 2 cut(s) 850, 902
BseAI TCCGGA 1 cut(s) 90
BseBI CCWGG 1 cut(s) 851
BseCI ATCGAT 1 cut(s) 267
BseDI CCNNGG 2 cut(s) 285, 586
BseLI CCNNNNNNNGG 2 cut(s) 850, 902
BseMII CTCAG 1 cut(s) 769
BseXI GCAGC 4 cut(s) 121, 138, 211, 325
BseYI CCCAGC 1 cut(s) 388
BsgI GTGCAG 1 cut(s) 137
BshFI GGCC 2 cut(s) 495, 750
BshVI ATCGAT 1 cut(s) 267
BsiHKAI GWGCWC 2 cut(s) 284, 532
BsiHKCI CYCGRG 1 cut(s) 342
BsiSI CCGG 3 cut(s) 91, 741, 903
BslI CCNNNNNNNGG 2 cut(s) 850, 902
BsmAI GTCTC 1 cut(s) 393
BsmBI CGTCTC 1 cut(s) 393
BsmI GAATGC 2 cut(s) 37, 112
BsnI GGCC 2 cut(s) 495, 750
BsoBI CYCGRG 1 cut(s) 342
Bsp1286I GDGCHC 2 cut(s) 284, 532
Bsp13I TCCGGA 1 cut(s) 90
Bsp143I GATC 4 cut(s) 3, 634, 763, 873
BspACI CCGC 1 cut(s) 680
BspANI GGCC 2 cut(s) 495, 750
BspCNI CTCAG 1 cut(s) 768
BspDI ATCGAT 1 cut(s) 267
BspEI TCCGGA 1 cut(s) 90
BspMAI CTGCAG 1 cut(s) 935
BspTI CTTAAG 1 cut(s) 358
BssECI CCNNGG 2 cut(s) 285, 586
BssMI GATC 4 cut(s) 3, 634, 763, 873
BssT1I CCWWGG 1 cut(s) 586
Bst2UI CCWGG 1 cut(s) 851
Bst4CI ACNGT 1 cut(s) 179
Bst6I CTCTTC 1 cut(s) 391
BstAFI CTTAAG 1 cut(s) 358
BstAPI GCANNNNNTGC 2 cut(s) 554, 860
BstDEI CTNAG 1 cut(s) 755
BstDSI CCRYGG 1 cut(s) 285
BstKTI GATC 4 cut(s) 6, 637, 766, 876
BstMAI GTCTC 1 cut(s) 393
BstMBI GATC 4 cut(s) 3, 634, 763, 873
BstMWI GCNNNNNNNGC 3 cut(s) 151, 554, 860
BstNI CCWGG 1 cut(s) 851
BstNSI RCATGY 2 cut(s) 69, 300
BstSCI CCNGG 2 cut(s) 849, 902
BstSFI CTRYAG 3 cut(s) 638, 826, 931
BstV1I GCAGC 4 cut(s) 121, 138, 211, 325
BstV2I GAAGAC 1 cut(s) 900
BstXI CCANNNNNNTGG 1 cut(s) 814
Bsu15I ATCGAT 1 cut(s) 267
BsuRI GGCC 2 cut(s) 495, 750
BsuTUI ATCGAT 1 cut(s) 267
BtgI CCRYGG 1 cut(s) 285
BtrI CACGTC 1 cut(s) 511
BtsI GCAGTG 1 cut(s) 675
BtsIMutI CAGTG 1 cut(s) 675
Cfr13I GGNCC 3 cut(s) 599, 748, 817
ClaI ATCGAT 1 cut(s) 267
CseI GACGC 1 cut(s) 177
Csp6I GTAC 3 cut(s) 45, 194, 804
CviAII CATG 3 cut(s) 66, 297, 375
CviQI GTAC 3 cut(s) 45, 194, 804
DdeI CTNAG 1 cut(s) 755
DpnI GATC 4 cut(s) 5, 636, 765, 875
DpnII GATC 4 cut(s) 3, 634, 763, 873
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
Eam1104I CTCTTC 1 cut(s) 391
EarI CTCTTC 1 cut(s) 391
Ecl136II GAGCTC 2 cut(s) 282, 530
Eco130I CCWWGG 1 cut(s) 586
Eco147I AGGCCT 1 cut(s) 495
Eco24I GRGCYC 2 cut(s) 284, 532
Eco47I GGWCC 2 cut(s) 599, 817
Eco53kI GAGCTC 2 cut(s) 282, 530
Eco88I CYCGRG 1 cut(s) 342
EcoICRI GAGCTC 2 cut(s) 282, 530
EcoO109I RGGNCCY 1 cut(s) 748
EcoRI GAATTC 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 849
EcoT14I CCWWGG 1 cut(s) 586
EcoT38I GRGCYC 2 cut(s) 284, 532
ErhI CCWWGG 1 cut(s) 586
Esp3I CGTCTC 1 cut(s) 393
FaeI CATG 3 cut(s) 69, 300, 378
FalI AAGNNNNNCTT 2 cut(s) 212, 244
FatI CATG 3 cut(s) 65, 296, 374
FbaI TGATCA 2 cut(s) 763, 873
Fnu4HI GCNGC 5 cut(s) 135, 152, 225, 339, 681
FriOI GRGCYC 2 cut(s) 284, 532
Fsp4HI GCNGC 5 cut(s) 135, 152, 225, 339, 681
FspBI CTAG 2 cut(s) 699, 780
GluI GCNGC 5 cut(s) 135, 152, 225, 339, 681
GsaI CCCAGC 1 cut(s) 392
GsuI CTGGAG 1 cut(s) 933
HaeIII GGCC 2 cut(s) 495, 750
HapII CCGG 3 cut(s) 91, 741, 903
HgaI GACGC 1 cut(s) 177
Hin1II CATG 3 cut(s) 69, 300, 378
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HinfI GANTC 2 cut(s) 347, 617
HpaII CCGG 3 cut(s) 91, 741, 903
HphI GGTGA 2 cut(s) 730, 892
Hpy166II GTNNAC 2 cut(s) 175, 896
Hpy188I TCNGA 5 cut(s) 105, 121, 234, 729, 763
Hpy188III TCNNGA 8 cut(s) 91, 277, 525, 602, 686, 699, 912, 948
Hpy8I GTNNAC 2 cut(s) 175, 896
Hpy99I CGWCG 2 cut(s) 193, 668
HpyAV CCTTC 3 cut(s) 214, 453, 761
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4IV ACGT 3 cut(s) 432, 510, 611
HpyCH4V TGCA 5 cut(s) 154, 272, 296, 557, 933
HpyF10VI GCNNNNNNNGC 3 cut(s) 151, 554, 860
HpyF3I CTNAG 1 cut(s) 755
HpySE526I ACGT 3 cut(s) 432, 510, 611
Hsp92II CATG 3 cut(s) 69, 300, 378
Kpn2I TCCGGA 1 cut(s) 90
Ksp22I TGATCA 2 cut(s) 763, 873
Kzo9I GATC 4 cut(s) 3, 634, 763, 873
LmnI GCTCC 3 cut(s) 287, 425, 527
Lsp1109I GCAGC 4 cut(s) 121, 138, 211, 325
LweI GCATC 3 cut(s) 175, 259, 454
MaeI CTAG 2 cut(s) 699, 780
MaeII ACGT 3 cut(s) 432, 510, 611
MaeIII GTNAC 2 cut(s) 502, 655
MalI GATC 4 cut(s) 5, 636, 765, 875
MboI GATC 4 cut(s) 3, 634, 763, 873
MboII GAAGA 4 cut(s) 68, 405, 408, 900
MfeI CAATTG 2 cut(s) 38, 537
MhlI GDGCHC 2 cut(s) 284, 532
MluCI AATT 7 cut(s) 38, 241, 370, 537, 774, 865, 943
MnlI CCTC 2 cut(s) 245, 359
MroI TCCGGA 1 cut(s) 90
MseI TTAA 3 cut(s) 359, 773, 942
MslI CAYNNNNRTG 1 cut(s) 509
MspCI CTTAAG 1 cut(s) 358
MspI CCGG 3 cut(s) 91, 741, 903
MspR9I CCNGG 2 cut(s) 851, 904
MunI CAATTG 2 cut(s) 38, 537
Mva1269I GAATGC 2 cut(s) 37, 112
MvaI CCWGG 1 cut(s) 851
MwoI GCNNNNNNNGC 3 cut(s) 151, 554, 860
NciI CCSGG 1 cut(s) 904
NdeII GATC 4 cut(s) 3, 634, 763, 873
NlaIII CATG 3 cut(s) 69, 300, 378
NmuCI GTSAC 2 cut(s) 502, 655
NspI RCATGY 2 cut(s) 69, 300
OliI CACNNNNGTG 1 cut(s) 509
PceI AGGCCT 1 cut(s) 495
PciI ACATGT 1 cut(s) 65
PctI GAATGC 2 cut(s) 37, 112
PfeI GAWTC 2 cut(s) 347, 617
PkrI GCNGC 5 cut(s) 136, 153, 226, 340, 682
PscI ACATGT 1 cut(s) 65
Psp124BI GAGCTC 2 cut(s) 284, 532
Psp1406I AACGTT 1 cut(s) 432
Psp6I CCWGG 1 cut(s) 849
PspFI CCCAGC 1 cut(s) 388
PspGI CCWGG 1 cut(s) 849
PspPI GGNCC 3 cut(s) 599, 748, 817
PstI CTGCAG 1 cut(s) 935
RsaI GTAC 3 cut(s) 46, 195, 805
RsaNI GTAC 3 cut(s) 45, 194, 804
RseI CAYNNNNRTG 1 cut(s) 509
SacI GAGCTC 2 cut(s) 284, 532
SaqAI TTAA 3 cut(s) 359, 773, 942
SatI GCNGC 5 cut(s) 135, 152, 225, 339, 681
Sau3AI GATC 4 cut(s) 3, 634, 763, 873
Sau96I GGNCC 3 cut(s) 599, 748, 817
ScrFI CCNGG 2 cut(s) 851, 904
SduI GDGCHC 2 cut(s) 284, 532
SfaNI GCATC 3 cut(s) 175, 259, 454
SfcI CTRYAG 3 cut(s) 638, 826, 931
SinI GGWCC 2 cut(s) 599, 817
SmiMI CAYNNNNRTG 1 cut(s) 509
SmlI CTYRAG 1 cut(s) 358
SmoI CTYRAG 1 cut(s) 358
Sse9I AATT 7 cut(s) 38, 241, 370, 537, 774, 865, 943
SseBI AGGCCT 1 cut(s) 495
SsiI CCGC 1 cut(s) 680
SspMI CTAG 2 cut(s) 699, 780
SstI GAGCTC 2 cut(s) 284, 532
StuI AGGCCT 1 cut(s) 495
StyD4I CCNGG 2 cut(s) 849, 902
StyI CCWWGG 1 cut(s) 586
TaaI ACNGT 1 cut(s) 179
TaiI ACGT 3 cut(s) 435, 513, 614
TaqI TCGA 3 cut(s) 201, 267, 711
TasI AATT 7 cut(s) 38, 241, 370, 537, 774, 865, 943
TauI GCSGC 1 cut(s) 683
TfiI GAWTC 2 cut(s) 347, 617
Tru1I TTAA 3 cut(s) 359, 773, 942
Tru9I TTAA 3 cut(s) 359, 773, 942
TscAI CASTG 1 cut(s) 682
TseFI GTSAC 2 cut(s) 502, 655
TseI GCWGC 4 cut(s) 134, 151, 224, 338
Tsp45I GTSAC 2 cut(s) 502, 655
TspDTI ATGAA 1 cut(s) 363
TspGWI ACGGA 3 cut(s) 62, 274, 681
TspRI CASTG 1 cut(s) 682
Vha464I CTTAAG 1 cut(s) 358
VpaK11BI GGWCC 2 cut(s) 599, 817
XapI RAATTY 2 cut(s) 241, 370
XbaI TCTAGA 1 cut(s) 698
XceI RCATGY 2 cut(s) 69, 300
XcmI CCANNNNNNNNNTGG 2 cut(s) 593, 847
XspI CTAG 2 cut(s) 699, 780
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.