Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003570.1

Orthogroup ID

OG0010111

Physical Location & Seq

Genomic Coordinates Reverse (-)

15944 .. 20522

Gene Structure 4579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003570.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 894 bp

ctggtacgcaaatttaacgcttcacttgagagcctatttatacaatggctttgctgctctttgctcactcaaaaactcactaaattgtctttctggttttctctctgtctttttgagctgatggatttgaagattcaaatgcagagggcaagggcaacctcttttgcttcttatactggcaatcttgggctactgctcctctggcatattctgcatctttttgtcagactatggtactttctgttgtggatggtttatgtgcttgagagctatctcatttctggtggaatacttaagaagtataaagcccttaacgtaggtaaactacggtacctggcaattgtagtagaaagtgaagaggcatacgaaacttccaaaattattcagcttctgcagtggctagaatctatgggcgtgaaacgtgtgtgcctctacgacacagaaggagtgttgaagaaatcaaaagaagtcatcttgacaaaactgaaaaatgcagtagtatatgaggaaggttatcaagatgaaagcttagttgaccaaaaacgcatgtctctagaattttgttcattctctgatggaaaagaagctataaccaaagcagctaacttgctctttgtgaagtatttgaaattggcaacactacctggtgatcatgaagagaaaatctttacagaacctcacatggatgatgcacttaaagctattggtggcagagggccggaccctgacctcctattagtttatggacctgcaagatgccaccttggttttcctgcatggagaatgcgatatactgagattgtacacatgggtcagctaatgcatatgagatacggttccctaattaaagccatttgcaggttcaccactgtgcgccaaaactatggtaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00900 ko01110 map00900 map01110

Pfam Domains

Protein Families

No domains found.

Protein Analysis

297

Amino Acids

34.38

Weight (kDa)

9.08

Isoelectric Point (pI)

30.28

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010111)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11755
fragaria_vesca	FvH4_2g08440 FvH4_2g08440 FvH4_2g08440
malus_domestica	MD10G1078800.v1.1
prunus_persica	Prupe.8G100600_v2.0.a1 Prupe.8G100800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0263721
rosa_laevigata	RLG00000014319
rosa_multiflora	Rmu_sc0003570.1_g000002
rosa_roxburghii	Rroxscaffold_176G00431180 Rroxscaffold_7G00204010
rosa_rugosa	Rorug06G0005800 Rorug06G0005900 Rorug06G0006000
rosa_samantha	Rh6AG125400 Rh6BG121700 Rh6CG120000 Rh6DG107800
rosa_wichuraiana	Rw0G005270 Rw6G010900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	2 cut(s)	757, 849
Acc65I	GGTACC	1 cut(s)	330
AccB1I	GGYRCC	1 cut(s)	330
AcsI	RAATTY	2 cut(s)	11, 557
AfaI	GTAC	4 cut(s)	6, 236, 332, 804
AfiI	CCNNNNNNNGG	1 cut(s)	858
AflII	CTTAAG	1 cut(s)	293
AflIII	ACRYGT	1 cut(s)	421
AgsI	TTSAA	4 cut(s)	130, 137, 454, 628
AjnI	CCWGG	2 cut(s)	333, 643
AleI	CACNNNNGTG	1 cut(s)	869
AluBI	AGCT	8 cut(s)	118, 270, 388, 528, 587, 602, 701, 817
AluI	AGCT	8 cut(s)	118, 270, 388, 528, 587, 602, 701, 817
Alw26I	GTCTC	1 cut(s)	555
AlwNI	CAGNNNCTG	1 cut(s)	391
AoxI	GGCC	1 cut(s)	716
ApeKI	GCWGC	2 cut(s)	54, 599
ApoI	RAATTY	2 cut(s)	11, 557
Asp718I	GGTACC	1 cut(s)	330
AspLEI	GCGC	1 cut(s)	876
AspS9I	GGNCC	3 cut(s)	716, 721, 746
AsuHPI	GGTGA	2 cut(s)	659, 856
AvaII	GGWCC	2 cut(s)	721, 746
BaeI	ACNNNNGTAYC	2 cut(s)	314, 347
BanI	GGYRCC	1 cut(s)	330
BbvI	GCAGC	2 cut(s)	41, 611
BccI	CCATC	3 cut(s)	115, 244, 569
BciT130I	CCWGG	2 cut(s)	335, 645
BclI	TGATCA	1 cut(s)	649
BcoDI	GTCTC	1 cut(s)	555
BfaI	CTAG	2 cut(s)	401, 554
BfmI	CTRYAG	1 cut(s)	392
BfrI	CTTAAG	1 cut(s)	293
BfuAI	ACCTGC	2 cut(s)	757, 849
BisI	GCNGC	2 cut(s)	55, 600
BlsI	GCNGC	2 cut(s)	56, 601
Bme1390I	CCNGG	2 cut(s)	335, 645
Bme18I	GGWCC	2 cut(s)	721, 746
BmgT120I	GGNCC	3 cut(s)	716, 721, 746
BmiI	GGNNCC	3 cut(s)	332, 723, 838
BmrFI	CCNGG	2 cut(s)	335, 645
BmsI	GCATC	3 cut(s)	223, 679, 746
BpuEI	CTTGAG	2 cut(s)	47, 284
BsaJI	CCNNGG	1 cut(s)	763
Bsc4I	CCNNNNNNNGG	1 cut(s)	858
Bse1I	ACTGG	1 cut(s)	181
BseBI	CCWGG	2 cut(s)	335, 645
BseDI	CCNNGG	1 cut(s)	763
BseGI	GGATG	2 cut(s)	255, 691
BseLI	CCNNNNNNNGG	1 cut(s)	858
BseMII	CTCAG	1 cut(s)	786
BseNI	ACTGG	1 cut(s)	181
BseRI	GAGGAG	1 cut(s)	188
BseXI	GCAGC	2 cut(s)	41, 611
BshFI	GGCC	1 cut(s)	718
BshNI	GGYRCC	1 cut(s)	330
BsiSI	CCGG	1 cut(s)	719
BslI	CCNNNNNNNGG	1 cut(s)	858
BsmAI	GTCTC	1 cut(s)	555
BsmI	GAATGC	1 cut(s)	789
BsnI	GGCC	1 cut(s)	718
Bsp1407I	TGTACA	1 cut(s)	802
Bsp143I	GATC	1 cut(s)	649
BspANI	GGCC	1 cut(s)	718
BspCNI	CTCAG	1 cut(s)	787
BspHI	TCATGA	1 cut(s)	652
BspLI	GGNNCC	3 cut(s)	332, 723, 838
BspMAI	CTGCAG	1 cut(s)	396
BspMI	ACCTGC	2 cut(s)	757, 849
BspT107I	GGYRCC	1 cut(s)	330
BspTI	CTTAAG	1 cut(s)	293
BsrGI	TGTACA	1 cut(s)	802
BsrI	ACTGG	1 cut(s)	181
BssECI	CCNNGG	1 cut(s)	763
BssMI	GATC	1 cut(s)	649
BssT1I	CCWWGG	1 cut(s)	763
Bst2UI	CCWGG	2 cut(s)	335, 645
Bst4CI	ACNGT	3 cut(s)	330, 836, 871
Bst6I	CTCTTC	2 cut(s)	351, 651
BstAFI	CTTAAG	1 cut(s)	293
BstAPI	GCANNNNNTGC	1 cut(s)	211
BstAUI	TGTACA	1 cut(s)	802
BstDEI	CTNAG	2 cut(s)	529, 795
BstF5I	GGATG	2 cut(s)	255, 691
BstHHI	GCGC	1 cut(s)	876
BstKTI	GATC	1 cut(s)	652
BstMAI	GTCTC	1 cut(s)	555
BstMBI	GATC	1 cut(s)	649
BstMWI	GCNNNNNNNGC	3 cut(s)	202, 211, 698
BstNI	CCWGG	2 cut(s)	335, 645
BstNSI	RCATGY	1 cut(s)	550
BstSCI	CCNGG	2 cut(s)	333, 643
BstSFI	CTRYAG	1 cut(s)	392
BstV1I	GCAGC	2 cut(s)	41, 611
BstXI	CCANNNNNNTGG	1 cut(s)	884
BsuRI	GGCC	1 cut(s)	718
BtsCI	GGATG	2 cut(s)	255, 691
BtsI	GCAGTG	1 cut(s)	401
BtsIMutI	CAGTG	2 cut(s)	401, 867
BveI	ACCTGC	2 cut(s)	757, 849
CaiI	CAGNNNCTG	1 cut(s)	391
CciI	TCATGA	1 cut(s)	652
CfoI	GCGC	1 cut(s)	876
Cfr13I	GGNCC	3 cut(s)	716, 721, 746
CsiI	ACCWGGT	1 cut(s)	643
Csp6I	GTAC	4 cut(s)	5, 235, 331, 803
CviAII	CATG	5 cut(s)	547, 653, 682, 777, 808
CviQI	GTAC	4 cut(s)	5, 235, 331, 803
DdeI	CTNAG	2 cut(s)	529, 795
DpnI	GATC	1 cut(s)	651
DpnII	GATC	1 cut(s)	649
Eam1104I	CTCTTC	2 cut(s)	351, 651
EarI	CTCTTC	2 cut(s)	351, 651
Eco130I	CCWWGG	1 cut(s)	763
Eco47I	GGWCC	2 cut(s)	721, 746
EcoRII	CCWGG	2 cut(s)	333, 643
EcoT14I	CCWWGG	1 cut(s)	763
EcoT22I	ATGCAT	1 cut(s)	825
ErhI	CCWWGG	1 cut(s)	763
FaeI	CATG	5 cut(s)	550, 656, 685, 780, 811
FatI	CATG	5 cut(s)	546, 652, 681, 776, 807
FauNDI	CATATG	1 cut(s)	825
FbaI	TGATCA	1 cut(s)	649
Fnu4HI	GCNGC	2 cut(s)	55, 600
FokI	GGATG	2 cut(s)	262, 698
Fsp4HI	GCNGC	2 cut(s)	55, 600
FspBI	CTAG	2 cut(s)	401, 554
GlaI	GCGC	1 cut(s)	875
GluI	GCNGC	2 cut(s)	55, 600
HaeIII	GGCC	1 cut(s)	718
HapII	CCGG	1 cut(s)	719
HhaI	GCGC	1 cut(s)	876
Hin1II	CATG	5 cut(s)	550, 656, 685, 780, 811
Hin6I	GCGC	1 cut(s)	874
HinP1I	GCGC	1 cut(s)	874
HincII	GTYRAC	1 cut(s)	535
HindII	GTYRAC	1 cut(s)	535
HindIII	AAGCTT	1 cut(s)	526
HinfI	GANTC	2 cut(s)	133, 404
HpaII	CCGG	1 cut(s)	719
HphI	GGTGA	2 cut(s)	659, 856
Hpy166II	GTNNAC	4 cut(s)	323, 535, 805, 864
Hpy188I	TCNGA	2 cut(s)	227, 574
Hpy188III	TCNNGA	4 cut(s)	475, 518, 554, 653
Hpy8I	GTNNAC	4 cut(s)	323, 535, 805, 864
HpyAV	CCTTC	2 cut(s)	437, 503
HpyCH4III	ACNGT	3 cut(s)	330, 836, 871
HpyCH4IV	ACGT	2 cut(s)	315, 421
HpyCH4V	TGCA	9 cut(s)	142, 214, 394, 494, 692, 752, 776, 823, 858
HpyF10VI	GCNNNNNNNGC	3 cut(s)	202, 211, 698
HpyF3I	CTNAG	2 cut(s)	529, 795
HpySE526I	ACGT	2 cut(s)	315, 421
Hsp92II	CATG	5 cut(s)	550, 656, 685, 780, 811
HspAI	GCGC	1 cut(s)	874
KpnI	GGTACC	1 cut(s)	334
Ksp22I	TGATCA	1 cut(s)	649
Kzo9I	GATC	1 cut(s)	649
LmnI	GCTCC	1 cut(s)	201
Lsp1109I	GCAGC	2 cut(s)	41, 611
LweI	GCATC	3 cut(s)	223, 679, 746
MabI	ACCWGGT	1 cut(s)	643
MaeI	CTAG	2 cut(s)	401, 554
MaeII	ACGT	2 cut(s)	315, 421
MalI	GATC	1 cut(s)	651
MboI	GATC	1 cut(s)	649
MboII	GAAGA	4 cut(s)	142, 368, 466, 668
MfeI	CAATTG	1 cut(s)	339
MluCI	AATT	7 cut(s)	11, 83, 339, 378, 557, 629, 843
MnlI	CCTC	9 cut(s)	138, 169, 209, 352, 440, 499, 687, 707, 740
Mph1103I	ATGCAT	1 cut(s)	825
MseI	TTAA	5 cut(s)	15, 294, 312, 696, 846
MslI	CAYNNNNRTG	2 cut(s)	684, 869
MspCI	CTTAAG	1 cut(s)	293
MspI	CCGG	1 cut(s)	719
MspR9I	CCNGG	2 cut(s)	335, 645
MunI	CAATTG	1 cut(s)	339
Mva1269I	GAATGC	1 cut(s)	789
MvaI	CCWGG	2 cut(s)	335, 645
MwoI	GCNNNNNNNGC	3 cut(s)	202, 211, 698
NdeI	CATATG	1 cut(s)	825
NdeII	GATC	1 cut(s)	649
NlaIII	CATG	5 cut(s)	550, 656, 685, 780, 811
NlaIV	GGNNCC	3 cut(s)	332, 723, 838
NsiI	ATGCAT	1 cut(s)	825
NspI	RCATGY	1 cut(s)	550
OliI	CACNNNNGTG	1 cut(s)	869
PagI	TCATGA	1 cut(s)	652
PctI	GAATGC	1 cut(s)	789
PfeI	GAWTC	2 cut(s)	133, 404
PkrI	GCNGC	2 cut(s)	56, 601
Psp6I	CCWGG	2 cut(s)	333, 643
PspGI	CCWGG	2 cut(s)	333, 643
PspN4I	GGNNCC	3 cut(s)	332, 723, 838
PspPI	GGNCC	3 cut(s)	716, 721, 746
PstI	CTGCAG	1 cut(s)	396
PstNI	CAGNNNCTG	1 cut(s)	391
RsaI	GTAC	4 cut(s)	6, 236, 332, 804
RsaNI	GTAC	4 cut(s)	5, 235, 331, 803
RseI	CAYNNNNRTG	2 cut(s)	684, 869
SaqAI	TTAA	5 cut(s)	15, 294, 312, 696, 846
SatI	GCNGC	2 cut(s)	55, 600
Sau3AI	GATC	1 cut(s)	649
Sau96I	GGNCC	3 cut(s)	716, 721, 746
ScrFI	CCNGG	2 cut(s)	335, 645
SexAI	ACCWGGT	1 cut(s)	643
SfaNI	GCATC	3 cut(s)	223, 679, 746
SfcI	CTRYAG	1 cut(s)	392
SinI	GGWCC	2 cut(s)	721, 746
SmiMI	CAYNNNNRTG	2 cut(s)	684, 869
SmlI	CTYRAG	3 cut(s)	26, 263, 293
SmoI	CTYRAG	3 cut(s)	26, 263, 293
Sse9I	AATT	7 cut(s)	11, 83, 339, 378, 557, 629, 843
SspMI	CTAG	2 cut(s)	401, 554
StyD4I	CCNGG	2 cut(s)	333, 643
StyI	CCWWGG	1 cut(s)	763
TaaI	ACNGT	3 cut(s)	330, 836, 871
TaiI	ACGT	2 cut(s)	318, 424
TasI	AATT	7 cut(s)	11, 83, 339, 378, 557, 629, 843
TatI	WGTACW	1 cut(s)	802
TfiI	GAWTC	2 cut(s)	133, 404
Tru1I	TTAA	5 cut(s)	15, 294, 312, 696, 846
Tru9I	TTAA	5 cut(s)	15, 294, 312, 696, 846
TscAI	CASTG	2 cut(s)	401, 874
TseI	GCWGC	2 cut(s)	54, 599
TspDTI	ATGAA	3 cut(s)	537, 555, 669
TspRI	CASTG	2 cut(s)	401, 874
Vha464I	CTTAAG	1 cut(s)	293
VpaK11BI	GGWCC	2 cut(s)	721, 746
XapI	RAATTY	2 cut(s)	11, 557
XbaI	TCTAGA	1 cut(s)	553
XceI	RCATGY	1 cut(s)	550
XspI	CTAG	2 cut(s)	401, 554
Zsp2I	ATGCAT	1 cut(s)	825

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.