Rmu_sc0003742.1_g000007

Polygalacturonase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003742.1
Physical Location & Seq
Reverse (-)
16216 .. 17446
1231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003742.1_g000007.1.cds

Sequence Viewer

Length: 999 bp
atggacctcaagctctccacccttctctgcttttctctgttcttctccaccatcctaaccccaactctctctgagctctgcaaccctcaagacaaaaaggttctcttcgaaatcaagaaagcctttaacaacccctacatcttgtcctcatggaaatccaactccgactgctgtaccggctgggacaacgtcgagtgtgatcccaacaccaaccgcatcaactccctcaccatcttcaccgacaaccgcctcaccggccaaatccccgcccaagtcggagacttgccctacctcgaaaccctcgtgctccgcaagctccccaatctcaccggtcccatccagccctccatcgccaagctcaagcacctcaagatgctcaggctcagctggaacggcctctcaggctcaatccctgacttcctcagccagctcaagaacctcaccttcctcgaactcaacttcaacaacttcacaggctccatccccagctcgctttctcagctaccgaacttattagcccttcatttagatcgcaaccagctcacaggtcatattcctagctcattcggacgattcgttggcaacgttccaggtctattcctctcccacaaccagctcacaggcaaaatcccaacctcatttgctaacatgaactttgttcaaatagacttttcacgcaacaagcttgaaggcgatgcgtcagttatattcgggttgaacaagacgacccaggctgtggatttgtcgaggaacatgctggacttcgatctgtccaaggtggttttttcgacaagcttgagttcggtggacttgaaccataacaggatcacagggagtattccggagcacttgacccaattggataatttgcagttgttcaatgtgagctacaacaggttgtgtggtaagattccggtaggtgggaagttgcagagctttgacaccacgtcgtatttccataaccgatgcctttgtggtgccccactcccaagttgctag

Protein Analysis

332

Amino Acids

36.91

Weight (kDa)

8.54

Isoelectric Point (pI)

29.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 977
AccB7I CCANNNNNTGG 1 cut(s) 736
AccIII TCCGGA 1 cut(s) 841
AciI CCGC 4 cut(s) 214, 247, 267, 310
AclI AACGTT 1 cut(s) 585
AclWI GGATC 2 cut(s) 194, 833
AcoI YGGCCR 1 cut(s) 256
AfaI GTAC 1 cut(s) 175
AfiI CCNNNNNNNGG 2 cut(s) 736, 920
AgeI ACCGGT 1 cut(s) 329
AgsI TTSAA 6 cut(s) 463, 662, 689, 718, 814, 880
AhdI GACNNNNNGTC 1 cut(s) 946
AjiI CACGTC 1 cut(s) 948
AjnI CCWGG 2 cut(s) 589, 729
Alw21I GWGCWC 3 cut(s) 78, 309, 849
Alw26I GTCTC 1 cut(s) 273
AlwI GGATC 2 cut(s) 194, 833
Aor13HI TCCGGA 1 cut(s) 841
AoxI GGCC 2 cut(s) 256, 394
AsiGI ACCGGT 1 cut(s) 329
AspS9I GGNCC 2 cut(s) 4, 332
AsuHPI GGTGA 5 cut(s) 220, 229, 244, 319, 433
AsuII TTCGAA 1 cut(s) 108
AvaII GGWCC 2 cut(s) 4, 332
BaeGI GKGCMC 1 cut(s) 982
BaeI ACNNNNGTAYC 2 cut(s) 157, 190
BanI GGYRCC 1 cut(s) 977
BanII GRGCYC 1 cut(s) 78
BauI CACGAG 1 cut(s) 302
Bbv12I GWGCWC 3 cut(s) 78, 309, 849
BbvCI CCTCAGC 1 cut(s) 422
BccI CCATC 5 cut(s) 59, 239, 344, 356, 488
BceAI ACGGC 1 cut(s) 409
BcgI CGANNNNNNTGC 2 cut(s) 736, 770
BciT130I CCWGG 2 cut(s) 591, 731
BcoDI GTCTC 1 cut(s) 273
BfaI CTAG 2 cut(s) 558, 997
BglI GCCNNNNNGGC 2 cut(s) 255, 402
BlpI GCTNAGC 1 cut(s) 383
Bme1390I CCNGG 2 cut(s) 591, 731
Bme18I GGWCC 2 cut(s) 4, 332
BmeRI GACNNNNNGTC 1 cut(s) 946
BmgBI CACGTC 1 cut(s) 948
BmgT120I GGNCC 2 cut(s) 4, 332
BmiI GGNNCC 3 cut(s) 334, 478, 979
BmrFI CCNGG 2 cut(s) 591, 731
BmsI GCATC 4 cut(s) 225, 363, 685, 956
Bpu10I CCTNAGC 2 cut(s) 377, 422
Bpu1102I GCTNAGC 1 cut(s) 383
Bpu14I TTCGAA 1 cut(s) 108
BpuEI CTTGAG 5 cut(s) 72, 344, 353, 416, 817
BsaJI CCNNGG 2 cut(s) 729, 774
BsaWI WCCGGW 3 cut(s) 329, 841, 913
Bsc4I CCNNNNNNNGG 2 cut(s) 736, 920
Bse118I RCCGGY 3 cut(s) 176, 254, 329
BseAI TCCGGA 1 cut(s) 841
BseBI CCWGG 2 cut(s) 591, 731
BseDI CCNNGG 2 cut(s) 729, 774
BseGI GGATG 3 cut(s) 51, 336, 480
BseLI CCNNNNNNNGG 2 cut(s) 736, 920
BseMII CTCAG 6 cut(s) 63, 391, 397, 414, 436, 512
BseSI GKGCMC 1 cut(s) 982
BseYI CCCAGC 2 cut(s) 180, 485
BshFI GGCC 2 cut(s) 258, 396
BshNI GGYRCC 1 cut(s) 977
BshTI ACCGGT 1 cut(s) 329
BsiHKAI GWGCWC 3 cut(s) 78, 309, 849
BsiSI CCGG 5 cut(s) 177, 255, 330, 842, 914
BslFI GGGAC 2 cut(s) 197, 318
BslI CCNNNNNNNGG 2 cut(s) 736, 920
BsmAI GTCTC 1 cut(s) 273
BsmFI GGGAC 2 cut(s) 197, 318
BsnI GGCC 2 cut(s) 258, 396
Bsp119I TTCGAA 1 cut(s) 108
Bsp1286I GDGCHC 4 cut(s) 78, 309, 849, 982
Bsp13I TCCGGA 1 cut(s) 841
Bsp143I GATC 4 cut(s) 199, 529, 766, 825
Bsp1720I GCTNAGC 1 cut(s) 383
BspACI CCGC 4 cut(s) 214, 247, 267, 310
BspANI GGCC 2 cut(s) 258, 396
BspCNI CTCAG 6 cut(s) 64, 390, 396, 413, 435, 511
BspEI TCCGGA 1 cut(s) 841
BspLI GGNNCC 3 cut(s) 334, 478, 979
BspPI GGATC 2 cut(s) 194, 833
BspT104I TTCGAA 1 cut(s) 108
BspT107I GGYRCC 1 cut(s) 977
BsrFI RCCGGY 3 cut(s) 176, 254, 329
BssAI RCCGGY 3 cut(s) 176, 254, 329
BssECI CCNNGG 2 cut(s) 729, 774
BssMI GATC 4 cut(s) 199, 529, 766, 825
BssSI CACGAG 1 cut(s) 302
BssT1I CCWWGG 1 cut(s) 774
Bst2BI CACGAG 1 cut(s) 302
Bst2UI CCWGG 2 cut(s) 591, 731
Bst6I CTCTTC 1 cut(s) 110
BstBI TTCGAA 1 cut(s) 108
BstC8I GCNNGC 3 cut(s) 314, 428, 491
BstDEI CTNAG 6 cut(s) 72, 377, 383, 400, 422, 498
BstF5I GGATG 3 cut(s) 51, 336, 480
BstKTI GATC 4 cut(s) 202, 532, 769, 828
BstMAI GTCTC 1 cut(s) 273
BstMBI GATC 4 cut(s) 199, 529, 766, 825
BstMWI GCNNNNNNNGC 6 cut(s) 177, 255, 313, 393, 402, 499
BstNI CCWGG 2 cut(s) 591, 731
BstNSI RCATGY 1 cut(s) 757
BstSCI CCNGG 2 cut(s) 589, 729
BstSLI GKGCMC 1 cut(s) 982
BsuRI GGCC 2 cut(s) 258, 396
BtgZI GCGATG 2 cut(s) 334, 708
BtrI CACGTC 1 cut(s) 948
BtsCI GGATG 3 cut(s) 51, 336, 480
Cac8I GCNNGC 3 cut(s) 314, 428, 491
Cfr10I RCCGGY 3 cut(s) 176, 254, 329
Cfr13I GGNCC 2 cut(s) 4, 332
CseI GACGC 1 cut(s) 687
Csp6I GTAC 1 cut(s) 174
CspAI ACCGGT 1 cut(s) 329
CviAII CATG 3 cut(s) 150, 649, 754
CviQI GTAC 1 cut(s) 174
DdeI CTNAG 6 cut(s) 72, 377, 383, 400, 422, 498
DpnI GATC 4 cut(s) 201, 531, 768, 827
DpnII GATC 4 cut(s) 199, 529, 766, 825
DriI GACNNNNNGTC 1 cut(s) 946
EaeI YGGCCR 1 cut(s) 256
Eam1104I CTCTTC 1 cut(s) 110
Eam1105I GACNNNNNGTC 1 cut(s) 946
EarI CTCTTC 1 cut(s) 110
Ecl136II GAGCTC 1 cut(s) 76
Eco130I CCWWGG 1 cut(s) 774
Eco24I GRGCYC 1 cut(s) 78
Eco47I GGWCC 2 cut(s) 4, 332
Eco53kI GAGCTC 1 cut(s) 76
EcoICRI GAGCTC 1 cut(s) 76
EcoRII CCWGG 2 cut(s) 589, 729
EcoT14I CCWWGG 1 cut(s) 774
EcoT38I GRGCYC 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 774
FaeI CATG 3 cut(s) 153, 652, 757
FaiI YATR 7 cut(s) 151, 552, 650, 707, 755, 819, 960
FalI AAGNNNNNCTT 4 cut(s) 89, 121, 107, 139
FaqI GGGAC 2 cut(s) 197, 318
FatI CATG 3 cut(s) 149, 648, 753
FauI CCCGC 1 cut(s) 274
FokI GGATG 3 cut(s) 38, 323, 467
FriOI GRGCYC 1 cut(s) 78
FspBI CTAG 2 cut(s) 558, 997
GsaI CCCAGC 2 cut(s) 184, 489
HaeIII GGCC 2 cut(s) 258, 396
HapII CCGG 5 cut(s) 177, 255, 330, 842, 914
HgaI GACGC 1 cut(s) 687
Hin1II CATG 3 cut(s) 153, 652, 757
HindIII AAGCTT 2 cut(s) 683, 793
HinfI GANTC 2 cut(s) 573, 910
HpaII CCGG 5 cut(s) 177, 255, 330, 842, 914
HphI GGTGA 5 cut(s) 220, 229, 244, 319, 433
Hpy166II GTNNAC 1 cut(s) 808
Hpy188I TCNGA 4 cut(s) 73, 166, 278, 569
Hpy188III TCNNGA 5 cut(s) 89, 115, 370, 433, 842
Hpy8I GTNNAC 1 cut(s) 808
Hpy99I CGWCG 2 cut(s) 194, 952
HpyAV CCTTC 4 cut(s) 32, 454, 530, 683
HpyCH4IV ACGT 3 cut(s) 189, 585, 947
HpyCH4V TGCA 3 cut(s) 81, 871, 931
HpyF10VI GCNNNNNNNGC 6 cut(s) 177, 255, 313, 393, 402, 499
HpyF3I CTNAG 6 cut(s) 72, 377, 383, 400, 422, 498
HpySE526I ACGT 3 cut(s) 189, 585, 947
Hsp92II CATG 3 cut(s) 153, 652, 757
Kpn2I TCCGGA 1 cut(s) 841
Kzo9I GATC 4 cut(s) 199, 529, 766, 825
LmnI GCTCC 4 cut(s) 312, 321, 482, 844
LweI GCATC 4 cut(s) 225, 363, 685, 956
MaeI CTAG 2 cut(s) 558, 997
MaeII ACGT 3 cut(s) 189, 585, 947
MalI GATC 4 cut(s) 201, 531, 768, 827
MboI GATC 4 cut(s) 199, 529, 766, 825
MboII GAAGA 3 cut(s) 34, 97, 226
MfeI CAATTG 1 cut(s) 857
MhlI GDGCHC 4 cut(s) 78, 309, 849, 982
MluCI AATT 2 cut(s) 857, 865
MmeI TCCRAC 3 cut(s) 183, 189, 256
MroI TCCGGA 1 cut(s) 841
MseI TTAA 1 cut(s) 126
MspA1I CMGCKG 1 cut(s) 387
MspI CCGG 5 cut(s) 177, 255, 330, 842, 914
MspR9I CCNGG 2 cut(s) 591, 731
MunI CAATTG 1 cut(s) 857
MvaI CCWGG 2 cut(s) 591, 731
MwoI GCNNNNNNNGC 6 cut(s) 177, 255, 313, 393, 402, 499
NdeII GATC 4 cut(s) 199, 529, 766, 825
NlaIII CATG 3 cut(s) 153, 652, 757
NlaIV GGNNCC 3 cut(s) 334, 478, 979
NspI RCATGY 1 cut(s) 757
NspV TTCGAA 1 cut(s) 108
PcsI WCGNNNNNNNCGW 3 cut(s) 300, 573, 582
PfeI GAWTC 2 cut(s) 573, 910
PflFI GACNNNGTC 1 cut(s) 188
PflMI CCANNNNNTGG 1 cut(s) 736
PinAI ACCGGT 1 cut(s) 329
Psp124BI GAGCTC 1 cut(s) 78
Psp1406I AACGTT 1 cut(s) 585
Psp6I CCWGG 2 cut(s) 589, 729
PspFI CCCAGC 2 cut(s) 180, 485
PspGI CCWGG 2 cut(s) 589, 729
PspN4I GGNNCC 3 cut(s) 334, 478, 979
PspPI GGNCC 2 cut(s) 4, 332
PsyI GACNNNGTC 1 cut(s) 188
PvuII CAGCTG 1 cut(s) 387
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SacI GAGCTC 1 cut(s) 78
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 4 cut(s) 199, 529, 766, 825
Sau96I GGNCC 2 cut(s) 4, 332
ScrFI CCNGG 2 cut(s) 591, 731
SduI GDGCHC 4 cut(s) 78, 309, 849, 982
SfaNI GCATC 4 cut(s) 225, 363, 685, 956
SfuI TTCGAA 1 cut(s) 108
SinI GGWCC 2 cut(s) 4, 332
SmlI CTYRAG 6 cut(s) 8, 87, 359, 368, 431, 796
SmoI CTYRAG 6 cut(s) 8, 87, 359, 368, 431, 796
Sse9I AATT 2 cut(s) 857, 865
SsiI CCGC 4 cut(s) 214, 247, 267, 310
SspMI CTAG 2 cut(s) 558, 997
SstI GAGCTC 1 cut(s) 78
StyD4I CCNGG 2 cut(s) 589, 729
StyI CCWWGG 1 cut(s) 774
TaiI ACGT 3 cut(s) 192, 588, 950
TaqI TCGA 7 cut(s) 108, 192, 294, 450, 746, 765, 788
TasI AATT 2 cut(s) 857, 865
TfiI GAWTC 2 cut(s) 573, 910
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TspDTI ATGAA 2 cut(s) 512, 665
Tth111I GACNNNGTC 1 cut(s) 188
Van91I CCANNNNNTGG 1 cut(s) 736
VpaK11BI GGWCC 2 cut(s) 4, 332
XceI RCATGY 1 cut(s) 757
XspI CTAG 2 cut(s) 558, 997
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.