Rmu_sc0004165.1_g000033

acid phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004165.1
OG0016475
Physical Location & Seq
Reverse (-)
103604 .. 105130
1527 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1179 bp
atggctgggagactcactgtaattcaatcagttacaactggcgtaccagtttatactatgcaatcagtaagacttcctatgtccatttgtaatactcttgatcgattgaacatgaactttctctggggacacactgcagaacagaagaaaactcatcttgtgaagtgggatacggtctgtaaacctaaatggtatggtgggttgggattgaagaagacatgtatgatgaatcaggcgttgttagccaaaactggatggaggcttctacaacaggaacaagggttgtgggctcaagctttgaataaaaaatatcttaaagatgattgcattatgcagaagctctcatcacattttccttctagttctagtacatggaaaggcatcctttatggcaacaggaacaagggaggtattcgaagtggtgatgacacgatcatatggaggttatctcagaatggtaatttttctgttaaatctgcttatcactctctatttttgaatttggaatctcaaccatggccatggaactttatttggaagcttcaagttcctcctaaggtgaaaacctttttatggacccttgtgcatgacagattgttaacgaatgaagtcagggttcgtagaggtttggctatagatactcgttgtctaaggtgcggcttcccgcttgaatccttggaccatctcttcaaagattgcactatttctatgagtatctggtctgccctccatcctacaagtgagttctcttccacttacaccattccctttaatgattggttgcttatcaatttaaagtcctctgtgagaatgcaatatgacgttccttggtgttgctattttggtatggggctttggtatatatggaaatggaggtgcagaatcatattggatcatacttttaaattgccagtttggccttctttaattattcatcagtttaccagagaatattttgaagcaaataagattacacatgctaaaccttcacgacaggtggctaatctgtgttggcattttccgcctcaggattggctcaaattaaatgttgatggcagtttgcataaaaatactgggattatatgtgctggaggagcccttcgaaatgatgagggtgaatggatgaatgggttttctgccaagttgggtagtggtcaagttgttgaagctgaactttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

392

Amino Acids

45.31

Weight (kDa)

9.45

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RVT PF13966 155 - 240 8.9e-23 zinc-binding in reverse transcriptase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 657, 665, 1022
AclWI GGATC 1 cut(s) 900
AcoI YGGCCR 1 cut(s) 518
AcsI RAATTY 1 cut(s) 499
AfaI GTAC 2 cut(s) 45, 370
AfiI CCNNNNNNNGG 1 cut(s) 573
AflIII ACRYGT 1 cut(s) 218
AluBI AGCT 4 cut(s) 296, 340, 541, 1169
AluI AGCT 4 cut(s) 296, 340, 541, 1169
Alw26I GTCTC 1 cut(s) 4
AlwI GGATC 1 cut(s) 900
AoxI GGCC 2 cut(s) 518, 917
ApoI RAATTY 1 cut(s) 499
AspS9I GGNCC 2 cut(s) 576, 679
AsuHPI GGTGA 3 cut(s) 434, 571, 1127
AsuII TTCGAA 2 cut(s) 415, 1102
AvaII GGWCC 2 cut(s) 576, 679
AxyI CCTNAGG 2 cut(s) 555, 1026
BaeI ACNNNNGTAYC 2 cut(s) 27, 60
BalI TGGCCA 1 cut(s) 520
BanII GRGCYC 2 cut(s) 292, 1099
BbsI GAAGAC 1 cut(s) 221
BccI CCATC 4 cut(s) 249, 690, 738, 1046
BciVI GTATCC 1 cut(s) 163
BcoDI GTCTC 1 cut(s) 4
BfaI CTAG 2 cut(s) 360, 366
BfmI CTRYAG 2 cut(s) 135, 633
BfuI GTATCC 1 cut(s) 163
BglI GCCNNNNNGGC 1 cut(s) 916
BisI GCNGC 1 cut(s) 658
BlsI GCNGC 1 cut(s) 659
Bme18I GGWCC 2 cut(s) 576, 679
BmgT120I GGNCC 2 cut(s) 576, 679
BmiI GGNNCC 2 cut(s) 578, 1096
BmrI ACTGGG 1 cut(s) 1083
BmsI GCATC 1 cut(s) 390
BmuI ACTGGG 1 cut(s) 1083
BpiI GAAGAC 1 cut(s) 221
BplI GAGNNNNNCTC 2 cut(s) 433, 465
BpmI CTGGAG 1 cut(s) 1110
Bpu14I TTCGAA 2 cut(s) 415, 1102
BpuEI CTTGAG 1 cut(s) 276
Bsa29I ATCGAT 1 cut(s) 103
BsaJI CCNNGG 4 cut(s) 515, 521, 675, 827
Bsc4I CCNNNNNNNGG 1 cut(s) 573
Bse1I ACTGG 5 cut(s) 43, 47, 256, 911, 1078
Bse21I CCTNAGG 2 cut(s) 555, 1026
BseCI ATCGAT 1 cut(s) 103
BseDI CCNNGG 4 cut(s) 515, 521, 675, 827
BseGI GGATG 4 cut(s) 260, 381, 730, 1128
BseLI CCNNNNNNNGG 1 cut(s) 573
BseMII CTCAG 2 cut(s) 464, 1040
BseNI ACTGG 5 cut(s) 43, 47, 256, 911, 1078
BseRI GAGGAG 1 cut(s) 1107
BseYI CCCAGC 1 cut(s) 5
BsgI GTGCAG 1 cut(s) 898
BshFI GGCC 2 cut(s) 520, 919
BshVI ATCGAT 1 cut(s) 103
BslFI GGGAC 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 573
BsmAI GTCTC 1 cut(s) 4
BsmFI GGGAC 1 cut(s) 141
BsmI GAATGC 1 cut(s) 816
BsnI GGCC 2 cut(s) 520, 919
Bsp119I TTCGAA 2 cut(s) 415, 1102
Bsp1286I GDGCHC 2 cut(s) 292, 1099
Bsp143I GATC 3 cut(s) 100, 432, 892
Bsp19I CCATGG 2 cut(s) 515, 521
BspACI CCGC 3 cut(s) 657, 665, 1022
BspANI GGCC 2 cut(s) 520, 919
BspCNI CTCAG 2 cut(s) 463, 1039
BspDI ATCGAT 1 cut(s) 103
BspLI GGNNCC 2 cut(s) 578, 1096
BspMAI CTGCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 900
BspT104I TTCGAA 2 cut(s) 415, 1102
BsrI ACTGG 5 cut(s) 43, 47, 256, 911, 1078
BssECI CCNNGG 4 cut(s) 515, 521, 675, 827
BssMI GATC 3 cut(s) 100, 432, 892
BssT1I CCWWGG 4 cut(s) 515, 521, 675, 827
Bst4CI ACNGT 2 cut(s) 19, 175
Bst6I CTCTTC 2 cut(s) 692, 754
BstBI TTCGAA 2 cut(s) 415, 1102
BstDEI CTNAG 4 cut(s) 450, 555, 650, 1026
BstDSI CCRYGG 2 cut(s) 515, 521
BstF5I GGATG 4 cut(s) 260, 381, 730, 1128
BstKTI GATC 3 cut(s) 103, 435, 895
BstMAI GTCTC 1 cut(s) 4
BstMBI GATC 3 cut(s) 100, 432, 892
BstMWI GCNNNNNNNGC 4 cut(s) 242, 916, 1021, 1094
BstNSI RCATGY 2 cut(s) 222, 980
BstSFI CTRYAG 2 cut(s) 135, 633
BstV2I GAAGAC 1 cut(s) 221
BstXI CCANNNNNNTGG 1 cut(s) 522
Bsu15I ATCGAT 1 cut(s) 103
Bsu36I CCTNAGG 2 cut(s) 555, 1026
BsuI GTATCC 1 cut(s) 163
BsuRI GGCC 2 cut(s) 520, 919
BsuTUI ATCGAT 1 cut(s) 103
BtgI CCRYGG 2 cut(s) 515, 521
BtsCI GGATG 4 cut(s) 260, 381, 730, 1128
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 2 cut(s) 15, 132
Cfr13I GGNCC 2 cut(s) 576, 679
ClaI ATCGAT 1 cut(s) 103
Csp6I GTAC 2 cut(s) 44, 369
CspCI CAANNNNNGTGG 2 cut(s) 266, 301
CviAII CATG 7 cut(s) 112, 219, 372, 516, 522, 587, 977
CviQI GTAC 2 cut(s) 44, 369
DdeI CTNAG 4 cut(s) 450, 555, 650, 1026
DpnI GATC 3 cut(s) 102, 434, 894
DpnII GATC 3 cut(s) 100, 432, 892
DraI TTTAAA 2 cut(s) 795, 904
EaeI YGGCCR 1 cut(s) 518
Eam1104I CTCTTC 2 cut(s) 692, 754
EarI CTCTTC 2 cut(s) 692, 754
EciI GGCGGA 1 cut(s) 1011
Eco130I CCWWGG 4 cut(s) 515, 521, 675, 827
Eco24I GRGCYC 2 cut(s) 292, 1099
Eco47I GGWCC 2 cut(s) 576, 679
Eco81I CCTNAGG 2 cut(s) 555, 1026
EcoT14I CCWWGG 4 cut(s) 515, 521, 675, 827
EcoT38I GRGCYC 2 cut(s) 292, 1099
ErhI CCWWGG 4 cut(s) 515, 521, 675, 827
FaeI CATG 7 cut(s) 115, 222, 375, 519, 525, 590, 980
FalI AAGNNNNNCTT 3 cut(s) 369, 401, 1158
FaqI GGGAC 1 cut(s) 141
FatI CATG 7 cut(s) 111, 218, 371, 515, 521, 586, 976
FauI CCCGC 1 cut(s) 672
FauNDI CATATG 1 cut(s) 437
Fnu4HI GCNGC 1 cut(s) 658
FokI GGATG 4 cut(s) 267, 368, 717, 1135
FriOI GRGCYC 2 cut(s) 292, 1099
Fsp4HI GCNGC 1 cut(s) 658
FspBI CTAG 2 cut(s) 360, 366
GluI GCNGC 1 cut(s) 658
GsaI CCCAGC 1 cut(s) 9
GsuI CTGGAG 1 cut(s) 1110
HaeIII GGCC 2 cut(s) 520, 919
Hin1II CATG 7 cut(s) 115, 222, 375, 519, 525, 590, 980
HincII GTYRAC 1 cut(s) 600
HindII GTYRAC 1 cut(s) 600
HindIII AAGCTT 2 cut(s) 294, 539
HinfI GANTC 5 cut(s) 12, 229, 506, 671, 882
HpaI GTTAAC 1 cut(s) 600
HphI GGTGA 3 cut(s) 434, 571, 1127
Hpy166II GTNNAC 3 cut(s) 182, 600, 942
Hpy188I TCNGA 1 cut(s) 453
Hpy188III TCNNGA 3 cut(s) 98, 990, 1028
Hpy8I GTNNAC 3 cut(s) 182, 600, 942
HpyAV CCTTC 4 cut(s) 366, 930, 996, 1109
HpyCH4III ACNGT 2 cut(s) 19, 175
HpyCH4IV ACGT 1 cut(s) 822
HpyCH4V TGCA 9 cut(s) 61, 137, 327, 334, 586, 699, 814, 879, 1063
HpyF10VI GCNNNNNNNGC 4 cut(s) 242, 916, 1021, 1094
HpyF3I CTNAG 4 cut(s) 450, 555, 650, 1026
HpySE526I ACGT 1 cut(s) 822
Hsp92II CATG 7 cut(s) 115, 222, 375, 519, 525, 590, 980
KspAI GTTAAC 1 cut(s) 600
Kzo9I GATC 3 cut(s) 100, 432, 892
LmnI GCTCC 1 cut(s) 1094
LweI GCATC 1 cut(s) 390
MaeI CTAG 2 cut(s) 360, 366
MaeII ACGT 1 cut(s) 822
MaeIII GTNAC 1 cut(s) 31
MalI GATC 3 cut(s) 102, 434, 894
MboI GATC 3 cut(s) 100, 432, 892
MboII GAAGA 5 cut(s) 157, 223, 226, 679, 741
MhlI GDGCHC 2 cut(s) 292, 1099
MlsI TGGCCA 1 cut(s) 520
MluCI AATT 7 cut(s) 21, 460, 499, 790, 905, 927, 1040
MluNI TGGCCA 1 cut(s) 520
MlyI GAGTC 1 cut(s) 6
Mox20I TGGCCA 1 cut(s) 520
MscI TGGCCA 1 cut(s) 520
MseI TTAA 8 cut(s) 315, 471, 599, 771, 794, 903, 926, 1043
MslI CAYNNNNRTG 1 cut(s) 520
Msp20I TGGCCA 1 cut(s) 520
Mva1269I GAATGC 1 cut(s) 816
MwoI GCNNNNNNNGC 4 cut(s) 242, 916, 1021, 1094
NcoI CCATGG 2 cut(s) 515, 521
NdeI CATATG 1 cut(s) 437
NdeII GATC 3 cut(s) 100, 432, 892
NlaIII CATG 7 cut(s) 115, 222, 375, 519, 525, 590, 980
NlaIV GGNNCC 2 cut(s) 578, 1096
NspI RCATGY 2 cut(s) 222, 980
NspV TTCGAA 2 cut(s) 415, 1102
PciI ACATGT 1 cut(s) 218
PctI GAATGC 1 cut(s) 816
PfeI GAWTC 4 cut(s) 229, 506, 671, 882
PkrI GCNGC 1 cut(s) 659
PleI GAGTC 1 cut(s) 6
PpsI GAGTC 1 cut(s) 6
PscI ACATGT 1 cut(s) 218
PspFI CCCAGC 1 cut(s) 5
PspN4I GGNNCC 2 cut(s) 578, 1096
PspPI GGNCC 2 cut(s) 576, 679
PstI CTGCAG 1 cut(s) 139
RsaI GTAC 2 cut(s) 45, 370
RsaNI GTAC 2 cut(s) 44, 369
RseI CAYNNNNRTG 1 cut(s) 520
SaqAI TTAA 8 cut(s) 315, 471, 599, 771, 794, 903, 926, 1043
SatI GCNGC 1 cut(s) 658
Sau3AI GATC 3 cut(s) 100, 432, 892
Sau96I GGNCC 2 cut(s) 576, 679
SchI GAGTC 1 cut(s) 6
SduI GDGCHC 2 cut(s) 292, 1099
SfaNI GCATC 1 cut(s) 390
SfcI CTRYAG 2 cut(s) 135, 633
SfuI TTCGAA 2 cut(s) 415, 1102
SinI GGWCC 2 cut(s) 576, 679
SmiMI CAYNNNNRTG 1 cut(s) 520
SmlI CTYRAG 1 cut(s) 291
SmoI CTYRAG 1 cut(s) 291
Sse9I AATT 7 cut(s) 21, 460, 499, 790, 905, 927, 1040
SsiI CCGC 3 cut(s) 657, 665, 1022
SspI AATATT 1 cut(s) 953
SspMI CTAG 2 cut(s) 360, 366
StyI CCWWGG 4 cut(s) 515, 521, 675, 827
TaaI ACNGT 2 cut(s) 19, 175
TaiI ACGT 1 cut(s) 825
TaqI TCGA 3 cut(s) 103, 415, 1102
TasI AATT 7 cut(s) 21, 460, 499, 790, 905, 927, 1040
TatI WGTACW 1 cut(s) 368
TauI GCSGC 1 cut(s) 660
TfiI GAWTC 4 cut(s) 229, 506, 671, 882
Tru1I TTAA 8 cut(s) 315, 471, 599, 771, 794, 903, 926, 1043
Tru9I TTAA 8 cut(s) 315, 471, 599, 771, 794, 903, 926, 1043
TscAI CASTG 2 cut(s) 22, 139
TspDTI ATGAA 5 cut(s) 128, 242, 621, 923, 1139
TspRI CASTG 2 cut(s) 22, 139
VpaK11BI GGWCC 2 cut(s) 576, 679
XapI RAATTY 1 cut(s) 499
XceI RCATGY 2 cut(s) 222, 980
XspI CTAG 2 cut(s) 360, 366
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.