Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004180.1

Orthogroup ID

OG0006829

Physical Location & Seq

Genomic Coordinates Forward (+)

182733 .. 184659

Gene Structure 1927 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004180.1_g000036.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 885 bp

atggcttcggggggcaccccaaatgctataattccggctgctgatacaagtcagtccaatccggcaagttcaacagctctaccacctattgacccaaaagcgaagggaaagaggaaggccggaaagtttcgatccgatgtttggctgcactttgagaggattgaggaatttgtaatgcttgctagaaagctagaattttggaaatctggaaatctgcgttctaggaccgatagcccgaaaacccggaccgattgttacggatcgggttatagtcggtctgaggtgggaaaatactgtgaaccgaaccgagaccgattactcgggttcggtctcggatttaaatggccgtcgggtaatagacccagatttctttcgacctccggttcatctgaacatgagaaaccccaaaacccaagtcagtacccaagtcaaaacccgaatttcaagcaccaagaaatcgaaggaccgactgtggagcgagacctctctgatttgggcaatgagacccgaacagtccttgaagtgatggccaagaacatgtatagtctgagtaggactgtggctgttctgggtttggttcagcttggccttggagcttacatttcatacatgactcggtcttcgccaatacccgaagtatcaattcagagctttttggcattcgggtttcccttctctttggcgttcatgttgaggcagtctctgaagccaatctacttctttaagaagatggaggagcaaggtagactgcagattctgactctttctcttcaggttgctaagaatttaaatgttttcttcattcgggttcgtggggtgtctgtcttgtgtattgctggtttgtctgctggagttttgttccagcttgcttacaagttgacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

294

Amino Acids

32.75

Weight (kDa)

9.79

Isoelectric Point (pI)

48.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006829)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12650
fragaria_vesca	FvH4_7g00860 FvH4_7g00860 FvH4_7g00860
malus_domestica	MD02G1314200.v1.1 MD07G1007900.v1.1
prunus_persica	Prupe.2G010600_v2.0.a1
pyrus_communis	pycom02g26340 pycom07g00650
rosa_chinensis	RchiOBHm_Chr1g0315011 RchiOBHm_Chr1g0315191 RchiOBHm_Chr1g0315371 RchiOBHm_Chr1g0315521 RchiOBHm_Chr1g0315651
rosa_laevigata	RLG00000030740
rosa_multiflora	Rmu_sc0000576.1_g000014 Rmu_sc0000576.1_g000024 Rmu_sc0004180.1_g000014 Rmu_sc0004180.1_g000036
rosa_roxburghii	Rroxscaffold_4G00331550
rosa_rugosa	Rorug01G0004600
rosa_samantha	Rh1AG014900 Rh1AG015800 Rh1BG007700 Rh1BG008100
rosa_wichuraiana	Rw1G000920

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	14
AccI	GTMKAC	1 cut(s)	745
AclWI	GGATC	2 cut(s)	126, 268
AcoI	YGGCCR	2 cut(s)	344, 528
AcsI	RAATTY	4 cut(s)	167, 194, 439, 784
AcuI	CTGAAG	2 cut(s)	725, 755
AfaI	GTAC	1 cut(s)	422
AfiI	CCNNNNNNNGG	1 cut(s)	141
AflIII	ACRYGT	1 cut(s)	537
AgsI	TTSAA	3 cut(s)	72, 445, 521
AluBI	AGCT	6 cut(s)	77, 190, 583, 596, 651, 865
AluI	AGCT	6 cut(s)	77, 190, 583, 596, 651, 865
Alw26I	GTCTC	5 cut(s)	303, 335, 474, 497, 705
AlwI	GGATC	2 cut(s)	126, 268
AlwNI	CAGNNNCTG	2 cut(s)	703, 757
Ama87I	CYCGRG	1 cut(s)	320
AoxI	GGCC	4 cut(s)	117, 344, 528, 586
ApeKI	GCWGC	2 cut(s)	38, 145
ApoI	RAATTY	4 cut(s)	167, 194, 439, 784
ArsI	GACNNNNNNTTYG	4 cut(s)	400, 432, 604, 636
AspS9I	GGNCC	3 cut(s)	225, 246, 464
AsuC2I	CCSGG	1 cut(s)	244
AvaI	CYCGRG	1 cut(s)	320
AvaII	GGWCC	3 cut(s)	225, 246, 464
BaeGI	GKGCMC	1 cut(s)	17
BalI	TGGCCA	1 cut(s)	530
BanI	GGYRCC	1 cut(s)	14
BarI	GAAGNNNNNNTAC	2 cut(s)	698, 730
BbsI	GAAGAC	1 cut(s)	612
BbvI	GCAGC	2 cut(s)	25, 132
BccI	CCATC	2 cut(s)	520, 724
BceAI	ACGGC	1 cut(s)	331
BcnI	CCSGG	1 cut(s)	244
BcoDI	GTCTC	5 cut(s)	303, 335, 474, 497, 705
BfaI	CTAG	3 cut(s)	183, 191, 222
BfmI	CTRYAG	1 cut(s)	749
BisI	GCNGC	2 cut(s)	39, 146
BlsI	GCNGC	2 cut(s)	40, 147
Bme1390I	CCNGG	1 cut(s)	244
Bme18I	GGWCC	3 cut(s)	225, 246, 464
BmeT110I	CYCGRG	1 cut(s)	320
BmgT120I	GGNCC	3 cut(s)	225, 246, 464
BmiI	GGNNCC	1 cut(s)	16
BmrFI	CCNGG	1 cut(s)	244
BpiI	GAAGAC	1 cut(s)	612
BplI	GAGNNNNNCTC	2 cut(s)	685, 717
BpmI	CTGGAG	1 cut(s)	870
BpuMI	CCSGG	1 cut(s)	244
BsaI	GGTCTC	4 cut(s)	303, 335, 474, 497
BsaJI	CCNNGG	1 cut(s)	589
BsaWI	WCCGGW	1 cut(s)	380
Bsc4I	CCNNNNNNNGG	1 cut(s)	141
Bse3DI	GCAATG	1 cut(s)	505
BseDI	CCNNGG	1 cut(s)	589
BseLI	CCNNNNNNNGG	1 cut(s)	141
BseMI	GCAATG	1 cut(s)	505
BseMII	CTCAG	2 cut(s)	270, 539
BseRI	GAGGAG	1 cut(s)	749
BseSI	GKGCMC	1 cut(s)	17
BseXI	GCAGC	2 cut(s)	25, 132
BsgI	GTGCAG	1 cut(s)	131
BshFI	GGCC	4 cut(s)	119, 346, 530, 588
BshNI	GGYRCC	1 cut(s)	14
BsiHKCI	CYCGRG	1 cut(s)	320
BsiSI	CCGG	5 cut(s)	35, 62, 120, 244, 381
BslI	CCNNNNNNNGG	1 cut(s)	141
BsmAI	GTCTC	5 cut(s)	303, 335, 474, 497, 705
BsmI	GAATGC	1 cut(s)	659
BsnI	GGCC	4 cut(s)	119, 346, 530, 588
Bso31I	GGTCTC	4 cut(s)	303, 335, 474, 497
BsoBI	CYCGRG	1 cut(s)	320
Bsp1286I	GDGCHC	1 cut(s)	17
Bsp143I	GATC	2 cut(s)	131, 260
BspANI	GGCC	4 cut(s)	119, 346, 530, 588
BspCNI	CTCAG	2 cut(s)	271, 540
BspLI	GGNNCC	1 cut(s)	16
BspMAI	CTGCAG	1 cut(s)	753
BspPI	GGATC	2 cut(s)	126, 268
BspT107I	GGYRCC	1 cut(s)	14
BspTNI	GGTCTC	4 cut(s)	303, 335, 474, 497
BsrDI	GCAATG	1 cut(s)	505
BssECI	CCNNGG	1 cut(s)	589
BssMI	GATC	2 cut(s)	131, 260
BssT1I	CCWWGG	1 cut(s)	589
Bst4CI	ACNGT	4 cut(s)	296, 472, 514, 559
Bst6I	CTCTTC	1 cut(s)	774
BstC8I	GCNNGC	2 cut(s)	180, 867
BstDEI	CTNAG	3 cut(s)	279, 548, 780
BstKTI	GATC	2 cut(s)	134, 263
BstMAI	GTCTC	5 cut(s)	303, 335, 474, 497, 705
BstMBI	GATC	2 cut(s)	131, 260
BstNSI	RCATGY	1 cut(s)	541
BstSCI	CCNGG	1 cut(s)	242
BstSFI	CTRYAG	1 cut(s)	749
BstSLI	GKGCMC	1 cut(s)	17
BstV1I	GCAGC	2 cut(s)	25, 132
BstV2I	GAAGAC	1 cut(s)	612
BsuRI	GGCC	4 cut(s)	119, 346, 530, 588
Cac8I	GCNNGC	2 cut(s)	180, 867
CaiI	CAGNNNCTG	2 cut(s)	703, 757
Cfr13I	GGNCC	3 cut(s)	225, 246, 464
CpoI	CGGWCCG	1 cut(s)	246
Csp6I	GTAC	1 cut(s)	421
CspI	CGGWCCG	1 cut(s)	246
CviAII	CATG	4 cut(s)	395, 538, 610, 688
CviQI	GTAC	1 cut(s)	421
DdeI	CTNAG	3 cut(s)	279, 548, 780
DpnI	GATC	2 cut(s)	133, 262
DpnII	GATC	2 cut(s)	131, 260
DraI	TTTAAA	2 cut(s)	340, 789
EaeI	YGGCCR	2 cut(s)	344, 528
Eam1104I	CTCTTC	1 cut(s)	774
EarI	CTCTTC	1 cut(s)	774
Eco130I	CCWWGG	1 cut(s)	589
Eco31I	GGTCTC	4 cut(s)	303, 335, 474, 497
Eco47I	GGWCC	3 cut(s)	225, 246, 464
Eco57I	CTGAAG	2 cut(s)	725, 755
Eco88I	CYCGRG	1 cut(s)	320
EcoT14I	CCWWGG	1 cut(s)	589
ErhI	CCWWGG	1 cut(s)	589
FaeI	CATG	4 cut(s)	398, 541, 613, 691
FaiI	YATR	8 cut(s)	29, 270, 396, 539, 543, 607, 611, 689
FatI	CATG	4 cut(s)	394, 537, 609, 687
FblI	GTMKAC	1 cut(s)	745
Fnu4HI	GCNGC	2 cut(s)	39, 146
Fsp4HI	GCNGC	2 cut(s)	39, 146
FspBI	CTAG	3 cut(s)	183, 191, 222
GluI	GCNGC	2 cut(s)	39, 146
GsuI	CTGGAG	1 cut(s)	870
HaeIII	GGCC	4 cut(s)	119, 346, 530, 588
HapII	CCGG	5 cut(s)	35, 62, 120, 244, 381
Hin1II	CATG	4 cut(s)	398, 541, 613, 691
HincII	GTYRAC	1 cut(s)	879
HindII	GTYRAC	1 cut(s)	879
HinfI	GANTC	3 cut(s)	613, 754, 760
HpaII	CCGG	5 cut(s)	35, 62, 120, 244, 381
Hpy166II	GTNNAC	3 cut(s)	299, 746, 879
Hpy188I	TCNGA	9 cut(s)	136, 280, 335, 391, 490, 549, 648, 705, 759
Hpy188III	TCNNGA	1 cut(s)	207
Hpy8I	GTNNAC	3 cut(s)	299, 746, 879
Hpy99I	CGWCG	1 cut(s)	352
HpyAV	CCTTC	4 cut(s)	97, 109, 455, 682
HpyCH4III	ACNGT	4 cut(s)	296, 472, 514, 559
HpyCH4V	TGCA	2 cut(s)	148, 751
HpyF3I	CTNAG	3 cut(s)	279, 548, 780
Hsp92II	CATG	4 cut(s)	398, 541, 613, 691
Kzo9I	GATC	2 cut(s)	131, 260
LmnI	GCTCC	3 cut(s)	475, 593, 736
Lsp1109I	GCAGC	2 cut(s)	25, 132
MaeI	CTAG	3 cut(s)	183, 191, 222
MaeIII	GTNAC	1 cut(s)	254
MalI	GATC	2 cut(s)	133, 262
MboI	GATC	2 cut(s)	131, 260
MboII	GAAGA	4 cut(s)	612, 739, 761, 790
MhlI	GDGCHC	1 cut(s)	17
MlsI	TGGCCA	1 cut(s)	530
MluCI	AATT	6 cut(s)	30, 167, 194, 439, 642, 784
MluNI	TGGCCA	1 cut(s)	530
MlyI	GAGTC	2 cut(s)	607, 754
MnlI	CCTC	8 cut(s)	105, 150, 157, 274, 388, 494, 687, 727
Mox20I	TGGCCA	1 cut(s)	530
MscI	TGGCCA	1 cut(s)	530
MseI	TTAA	3 cut(s)	339, 723, 788
Msp20I	TGGCCA	1 cut(s)	530
MspI	CCGG	5 cut(s)	35, 62, 120, 244, 381
MspR9I	CCNGG	1 cut(s)	244
Mva1269I	GAATGC	1 cut(s)	659
NciI	CCSGG	1 cut(s)	244
NdeII	GATC	2 cut(s)	131, 260
NlaIII	CATG	4 cut(s)	398, 541, 613, 691
NlaIV	GGNNCC	1 cut(s)	16
NspI	RCATGY	1 cut(s)	541
PciI	ACATGT	1 cut(s)	537
PctI	GAATGC	1 cut(s)	659
PfeI	GAWTC	1 cut(s)	754
PflFI	GACNNNGTC	1 cut(s)	616
PkrI	GCNGC	2 cut(s)	40, 147
PleI	GAGTC	2 cut(s)	607, 754
PpsI	GAGTC	2 cut(s)	607, 754
PscI	ACATGT	1 cut(s)	537
PspN4I	GGNNCC	1 cut(s)	16
PspPI	GGNCC	3 cut(s)	225, 246, 464
PstI	CTGCAG	1 cut(s)	753
PstNI	CAGNNNCTG	2 cut(s)	703, 757
PsyI	GACNNNGTC	1 cut(s)	616
RsaI	GTAC	1 cut(s)	422
RsaNI	GTAC	1 cut(s)	421
Rsr2I	CGGWCCG	1 cut(s)	246
RsrII	CGGWCCG	1 cut(s)	246
SaqAI	TTAA	3 cut(s)	339, 723, 788
SatI	GCNGC	2 cut(s)	39, 146
Sau3AI	GATC	2 cut(s)	131, 260
Sau96I	GGNCC	3 cut(s)	225, 246, 464
SchI	GAGTC	2 cut(s)	607, 754
ScrFI	CCNGG	1 cut(s)	244
SduI	GDGCHC	1 cut(s)	17
SfcI	CTRYAG	1 cut(s)	749
SinI	GGWCC	3 cut(s)	225, 246, 464
SmiI	ATTTAAAT	2 cut(s)	340, 789
Sse9I	AATT	6 cut(s)	30, 167, 194, 439, 642, 784
SspMI	CTAG	3 cut(s)	183, 191, 222
StyD4I	CCNGG	1 cut(s)	242
StyI	CCWWGG	1 cut(s)	589
SwaI	ATTTAAAT	2 cut(s)	340, 789
TaaI	ACNGT	4 cut(s)	296, 472, 514, 559
TaqI	TCGA	3 cut(s)	130, 374, 459
TaqII	GACCGA	7 cut(s)	242, 263, 264, 317, 327, 481, 606
TasI	AATT	6 cut(s)	30, 167, 194, 439, 642, 784
TfiI	GAWTC	1 cut(s)	754
Tru1I	TTAA	3 cut(s)	339, 723, 788
Tru9I	TTAA	3 cut(s)	339, 723, 788
TseI	GCWGC	2 cut(s)	38, 145
TspDTI	ATGAA	4 cut(s)	375, 594, 676, 790
TspGWI	ACGGA	1 cut(s)	273
Tth111I	GACNNNGTC	1 cut(s)	616
VpaK11BI	GGWCC	3 cut(s)	225, 246, 464
XapI	RAATTY	4 cut(s)	167, 194, 439, 784
XceI	RCATGY	1 cut(s)	541
XmiI	GTMKAC	1 cut(s)	745
XspI	CTAG	3 cut(s)	183, 191, 222

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.