Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004584.1

Orthogroup ID

OG0004361

Physical Location & Seq

Genomic Coordinates Reverse (-)

26679 .. 29491

Gene Structure 2813 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004584.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1152 bp

atggatatgtggatgttaggcattatggtggatccaggcttgaaagcaaaaatagatggtgggtctataacagagcatgaattggcctttacccttgtttcatttgcttgtctgctctttctaatctcttcattggttgatcagaacactaagaattggcctttaattgctcctttgccgtcttatggaagagggagagaacgccctggagggagatatgtgagcttcatccatggcgatggagttcatgatgtggttatcactggtgagaatgggacaattgatggccaaggagatgtgtggtggaacatgtggaggcaaagaactcttcaattcaccagaccaaatctcattgagttcatcaactctaaaaacattatcatttccaatgtgattttccagaactctccattttggaatattcaccctgtttattccagcaacattgttgtccggtatgtcacaatattggctccagctgactctcccaacacagatggaattgatccagattcaagctctaatgtctgcatagaggactcgtacatatcaactggagatgatcttgtggctgtaaagagtggatgggatgagtatgggattgcttatggtcgccctagttccgacattaccatccgtcggatcagaggatcatccccattttctggaattgcaataggaagtgaaacctctggtggggtggagaatgtatttgccgaacacataaacctttacaacatgggagttggtatccatataaaaacaaacatcggtaggggaggcttcataagaaacataacagtttcaaatgtgttcatagaaaaggcacggaagggtataaagattgcaggagatgttggagaccaccctgatgacaaattcaatccaaatgcactcccagtggtaaagggcatcacattgacagacatctggggtatacaagttctgcaggcaggtctcatacaaggcatcaagaactcccctttcaccggaatctgtctttccaacatcaacctccatggcatgaccgcaacaacgagaacacctccatggaagtgctcagatgtcagcggggctgctcatctggtgagccccatccaatgctccgagttgaccagtgcccaacacgcaacttcatgctccaactactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_hydro_28

Protein Analysis

383

Amino Acids

41.66

Weight (kDa)

5.92

Isoelectric Point (pI)

40.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004361)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G23820 AT5G41870
fragaria_vesca	FvH4_5g04440
malus_domestica	MD06G1105300.v1.1 MD14G1127400.v1.1
prunus_persica	Prupe.5G117600_v2.0.a1 Prupe.5G117600_v2.0.a1
pyrus_communis	pycom06g09960
rosa_chinensis	RchiOBHm_Chr6g0245371 RchiOBHm_Chr7g0195091
rosa_laevigata	RLG00000004148 RLG00000015306
rosa_multiflora	Rmu_sc0004584.1_g000009
rosa_roxburghii	Rroxscaffold_3G00260790
rosa_rugosa	Rorug07G0020300 Rorug07G0020400 Rorug07G0020500
rosa_samantha	Rh6BG025300 Rh6BG025900 Rh6BG026000 Rh6BG026100 Rh6BG026400 Rh6CG023600 Rh6CG024900 Rh6DG023600 Rh6DG024300 Rh7AG147900 Rh7BG148500 Rh7CG152100 Rh7DG149100
rosa_wichuraiana	Rw6G002480 Rw7G012620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	944
AccB7I	CCANNNNNTGG	1 cut(s)	665
AccI	GTMKAC	1 cut(s)	937
AciI	CCGC	2 cut(s)	1029, 1071
AclWI	GGATC	5 cut(s)	26, 39, 500, 650, 658
AcoI	YGGCCR	1 cut(s)	286
AcsI	RAATTY	1 cut(s)	878
AfaI	GTAC	1 cut(s)	545
AfiI	CCNNNNNNNGG	5 cut(s)	185, 639, 665, 696, 989
AflIII	ACRYGT	1 cut(s)	309
AgsI	TTSAA	5 cut(s)	43, 332, 516, 807, 883
AjnI	CCWGG	2 cut(s)	34, 205
AjuI	GAANNNNNNNTTGG	2 cut(s)	380, 412
AluBI	AGCT	3 cut(s)	225, 479, 519
AluI	AGCT	3 cut(s)	225, 479, 519
Alw21I	GWGCWC	1 cut(s)	1061
Alw26I	GTCTC	2 cut(s)	855, 962
AlwI	GGATC	5 cut(s)	26, 39, 500, 650, 658
AoxI	GGCC	3 cut(s)	84, 158, 286
ApeKI	GCWGC	1 cut(s)	1076
ApoI	RAATTY	1 cut(s)	878
AsuHPI	GGTGA	5 cut(s)	278, 328, 416, 979, 1099
BaeGI	GKGCMC	1 cut(s)	1123
BalI	TGGCCA	1 cut(s)	288
BamHI	GGATCC	1 cut(s)	31
BanII	GRGCYC	1 cut(s)	1094
Bbv12I	GWGCWC	1 cut(s)	1061
BbvI	GCAGC	1 cut(s)	1063
BccI	CCATC	7 cut(s)	50, 233, 278, 491, 579, 641, 1103
BceAI	ACGGC	1 cut(s)	163
BciT130I	CCWGG	2 cut(s)	36, 207
BciVI	GTATCC	1 cut(s)	761
BclI	TGATCA	1 cut(s)	139
BcoDI	GTCTC	2 cut(s)	855, 962
BfaI	CTAG	1 cut(s)	618
BfmI	CTRYAG	1 cut(s)	947
BfuAI	ACCTGC	1 cut(s)	944
BfuI	GTATCC	1 cut(s)	761
BisI	GCNGC	1 cut(s)	1077
BlsI	GCNGC	1 cut(s)	1078
Bme1390I	CCNGG	2 cut(s)	36, 207
BmiI	GGNNCC	2 cut(s)	33, 474
BmrFI	CCNGG	2 cut(s)	36, 207
BmrI	ACTGGG	1 cut(s)	893
BmsI	GCATC	2 cut(s)	921, 978
BmuI	ACTGGG	1 cut(s)	893
BplI	GAGNNNNNCTC	2 cut(s)	1030, 1062
BpmI	CTGGAG	3 cut(s)	228, 459, 576
BsaI	GGTCTC	2 cut(s)	855, 962
BsaJI	CCNNGG	5 cut(s)	205, 232, 289, 1018, 1049
BsaWI	WCCGGW	2 cut(s)	453, 989
Bsc4I	CCNNNNNNNGG	5 cut(s)	185, 639, 665, 696, 989
Bse1I	ACTGG	4 cut(s)	268, 559, 899, 1116
BseBI	CCWGG	2 cut(s)	36, 207
BseDI	CCNNGG	5 cut(s)	205, 232, 289, 1018, 1049
BseGI	GGATG	7 cut(s)	18, 228, 590, 595, 633, 653, 1095
BseLI	CCNNNNNNNGG	5 cut(s)	185, 639, 665, 696, 989
BseMII	CTCAG	1 cut(s)	1074
BseNI	ACTGG	4 cut(s)	268, 559, 899, 1116
BseSI	GKGCMC	1 cut(s)	1123
BseXI	GCAGC	1 cut(s)	1063
BshFI	GGCC	3 cut(s)	86, 160, 288
BsiHKAI	GWGCWC	1 cut(s)	1061
BsiSI	CCGG	2 cut(s)	454, 990
BslFI	GGGAC	1 cut(s)	289
BslI	CCNNNNNNNGG	5 cut(s)	185, 639, 665, 696, 989
BsmAI	GTCTC	2 cut(s)	855, 962
BsmFI	GGGAC	1 cut(s)	289
BsnI	GGCC	3 cut(s)	86, 160, 288
Bso31I	GGTCTC	2 cut(s)	855, 962
Bsp1286I	GDGCHC	3 cut(s)	1061, 1094, 1123
Bsp143I	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
Bsp19I	CCATGG	3 cut(s)	232, 1018, 1049
BspACI	CCGC	2 cut(s)	1029, 1071
BspANI	GGCC	3 cut(s)	86, 160, 288
BspCNI	CTCAG	1 cut(s)	1073
BspHI	TCATGA	1 cut(s)	247
BspLI	GGNNCC	2 cut(s)	33, 474
BspMAI	CTGCAG	1 cut(s)	951
BspMI	ACCTGC	1 cut(s)	944
BspPI	GGATC	5 cut(s)	26, 39, 500, 650, 658
BspTNI	GGTCTC	2 cut(s)	855, 962
BsrI	ACTGG	4 cut(s)	268, 559, 899, 1116
BssECI	CCNNGG	5 cut(s)	205, 232, 289, 1018, 1049
BssMI	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
BssNAI	GTATAC	1 cut(s)	938
BssT1I	CCWWGG	4 cut(s)	232, 289, 1018, 1049
Bst1107I	GTATAC	1 cut(s)	938
Bst2UI	CCWGG	2 cut(s)	36, 207
Bst4CI	ACNGT	1 cut(s)	802
Bst6I	CTCTTC	3 cut(s)	133, 184, 333
BstC8I	GCNNGC	1 cut(s)	951
BstDEI	CTNAG	2 cut(s)	150, 1060
BstDSI	CCRYGG	3 cut(s)	232, 1018, 1049
BstF5I	GGATG	7 cut(s)	18, 228, 590, 595, 633, 653, 1095
BstKTI	GATC	6 cut(s)	34, 142, 508, 565, 645, 653
BstMAI	GTCTC	2 cut(s)	855, 962
BstMBI	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
BstMWI	GCNNNNNNNGC	1 cut(s)	1127
BstNI	CCWGG	2 cut(s)	36, 207
BstNSI	RCATGY	1 cut(s)	313
BstSCI	CCNGG	2 cut(s)	34, 205
BstSFI	CTRYAG	1 cut(s)	947
BstSLI	GKGCMC	1 cut(s)	1123
BstV1I	GCAGC	1 cut(s)	1063
BstX2I	RGATCY	1 cut(s)	31
BstXI	CCANNNNNNTGG	1 cut(s)	239
BstYI	RGATCY	1 cut(s)	31
BstZ17I	GTATAC	1 cut(s)	938
BsuI	GTATCC	1 cut(s)	761
BsuRI	GGCC	3 cut(s)	86, 160, 288
BtgI	CCRYGG	3 cut(s)	232, 1018, 1049
BtgZI	GCGATG	1 cut(s)	252
BtsCI	GGATG	7 cut(s)	18, 228, 590, 595, 633, 653, 1095
BtsIMutI	CAGTG	3 cut(s)	261, 906, 1123
BveI	ACCTGC	1 cut(s)	944
Cac8I	GCNNGC	1 cut(s)	951
CciI	TCATGA	1 cut(s)	247
Csp6I	GTAC	1 cut(s)	544
CviAII	CATG	9 cut(s)	77, 233, 248, 310, 739, 1019, 1024, 1050, 1137
CviQI	GTAC	1 cut(s)	544
DdeI	CTNAG	2 cut(s)	150, 1060
DpnI	GATC	6 cut(s)	33, 141, 507, 564, 644, 652
DpnII	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
EaeI	YGGCCR	1 cut(s)	286
Eam1104I	CTCTTC	3 cut(s)	133, 184, 333
EarI	CTCTTC	3 cut(s)	133, 184, 333
Eco130I	CCWWGG	4 cut(s)	232, 289, 1018, 1049
Eco24I	GRGCYC	1 cut(s)	1094
Eco31I	GGTCTC	2 cut(s)	855, 962
EcoRII	CCWGG	2 cut(s)	34, 205
EcoT14I	CCWWGG	4 cut(s)	232, 289, 1018, 1049
EcoT38I	GRGCYC	1 cut(s)	1094
ErhI	CCWWGG	4 cut(s)	232, 289, 1018, 1049
FaeI	CATG	9 cut(s)	80, 236, 251, 313, 742, 1022, 1027, 1053, 1140
FaqI	GGGAC	1 cut(s)	289
FatI	CATG	9 cut(s)	76, 232, 247, 309, 738, 1018, 1023, 1049, 1136
FauI	CCCGC	1 cut(s)	1064
FbaI	TGATCA	1 cut(s)	139
FblI	GTMKAC	1 cut(s)	937
Fnu4HI	GCNGC	1 cut(s)	1077
FokI	GGATG	7 cut(s)	25, 215, 597, 602, 620, 640, 1082
FriOI	GRGCYC	1 cut(s)	1094
Fsp4HI	GCNGC	1 cut(s)	1077
FspBI	CTAG	1 cut(s)	618
GluI	GCNGC	1 cut(s)	1077
GsuI	CTGGAG	3 cut(s)	228, 459, 576
HaeIII	GGCC	3 cut(s)	86, 160, 288
HapII	CCGG	2 cut(s)	454, 990
Hin1II	CATG	9 cut(s)	80, 236, 251, 313, 742, 1022, 1027, 1053, 1140
HincII	GTYRAC	1 cut(s)	1113
HindII	GTYRAC	1 cut(s)	1113
HinfI	GANTC	4 cut(s)	482, 512, 539, 993
HpaII	CCGG	2 cut(s)	454, 990
HphI	GGTGA	5 cut(s)	278, 328, 416, 979, 1099
Hpy166II	GTNNAC	2 cut(s)	938, 1113
Hpy188I	TCNGA	6 cut(s)	144, 625, 642, 647, 1063, 1108
Hpy188III	TCNNGA	5 cut(s)	248, 400, 509, 666, 973
Hpy8I	GTNNAC	2 cut(s)	938, 1113
Hpy99I	CGWCG	1 cut(s)	642
HpyAV	CCTTC	1 cut(s)	826
HpyCH4III	ACNGT	1 cut(s)	802
HpyCH4V	TGCA	5 cut(s)	531, 674, 848, 893, 949
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1127
HpyF3I	CTNAG	2 cut(s)	150, 1060
Hsp92II	CATG	9 cut(s)	80, 236, 251, 313, 742, 1022, 1027, 1053, 1140
Ksp22I	TGATCA	1 cut(s)	139
Kzo9I	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
LmnI	GCTCC	4 cut(s)	175, 478, 1109, 1145
Lsp1109I	GCAGC	1 cut(s)	1063
LweI	GCATC	2 cut(s)	921, 978
MaeI	CTAG	1 cut(s)	618
MaeIII	GTNAC	1 cut(s)	460
MalI	GATC	6 cut(s)	33, 141, 507, 564, 644, 652
MboI	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
MboII	GAAGA	3 cut(s)	120, 201, 320
MfeI	CAATTG	1 cut(s)	279
MflI	RGATCY	1 cut(s)	31
MhlI	GDGCHC	3 cut(s)	1061, 1094, 1123
MlsI	TGGCCA	1 cut(s)	288
MluCI	AATT	8 cut(s)	80, 154, 165, 279, 332, 501, 669, 878
MluNI	TGGCCA	1 cut(s)	288
MlyI	GAGTC	2 cut(s)	476, 533
MmeI	TCCRAC	4 cut(s)	620, 648, 838, 1029
MnlI	CCTC	9 cut(s)	185, 203, 309, 529, 641, 700, 773, 1025, 1056
Mox20I	TGGCCA	1 cut(s)	288
MscI	TGGCCA	1 cut(s)	288
MseI	TTAA	1 cut(s)	164
MslI	CAYNNNNRTG	5 cut(s)	26, 237, 870, 1048, 1054
Msp20I	TGGCCA	1 cut(s)	288
MspA1I	CMGCKG	2 cut(s)	479, 1071
MspI	CCGG	2 cut(s)	454, 990
MspR9I	CCNGG	2 cut(s)	36, 207
MunI	CAATTG	1 cut(s)	279
MvaI	CCWGG	2 cut(s)	36, 207
MwoI	GCNNNNNNNGC	1 cut(s)	1127
NcoI	CCATGG	3 cut(s)	232, 1018, 1049
NdeII	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
NlaIII	CATG	9 cut(s)	80, 236, 251, 313, 742, 1022, 1027, 1053, 1140
NlaIV	GGNNCC	2 cut(s)	33, 474
NmuCI	GTSAC	1 cut(s)	460
NspI	RCATGY	1 cut(s)	313
PagI	TCATGA	1 cut(s)	247
PciI	ACATGT	1 cut(s)	309
PfeI	GAWTC	2 cut(s)	512, 993
PflMI	CCANNNNNTGG	1 cut(s)	665
PkrI	GCNGC	1 cut(s)	1078
PleI	GAGTC	2 cut(s)	476, 533
PpsI	GAGTC	2 cut(s)	476, 533
PscI	ACATGT	1 cut(s)	309
Psp6I	CCWGG	2 cut(s)	34, 205
PspGI	CCWGG	2 cut(s)	34, 205
PspN4I	GGNNCC	2 cut(s)	33, 474
PstI	CTGCAG	1 cut(s)	951
PsuI	RGATCY	1 cut(s)	31
PvuII	CAGCTG	1 cut(s)	479
RsaI	GTAC	1 cut(s)	545
RsaNI	GTAC	1 cut(s)	544
RseI	CAYNNNNRTG	5 cut(s)	26, 237, 870, 1048, 1054
SaqAI	TTAA	1 cut(s)	164
SatI	GCNGC	1 cut(s)	1077
Sau3AI	GATC	6 cut(s)	31, 139, 505, 562, 642, 650
SchI	GAGTC	2 cut(s)	476, 533
ScrFI	CCNGG	2 cut(s)	36, 207
SduI	GDGCHC	3 cut(s)	1061, 1094, 1123
SetI	ASST	8 cut(s)	227, 481, 521, 692, 732, 958, 1017, 1048
SfaNI	GCATC	2 cut(s)	921, 978
SfcI	CTRYAG	1 cut(s)	947
SmiMI	CAYNNNNRTG	5 cut(s)	26, 237, 870, 1048, 1054
Sse9I	AATT	8 cut(s)	80, 154, 165, 279, 332, 501, 669, 878
SsiI	CCGC	2 cut(s)	1029, 1071
SspI	AATATT	2 cut(s)	421, 468
SspMI	CTAG	1 cut(s)	618
StyD4I	CCNGG	2 cut(s)	34, 205
StyI	CCWWGG	4 cut(s)	232, 289, 1018, 1049
TaaI	ACNGT	1 cut(s)	802
TasI	AATT	8 cut(s)	80, 154, 165, 279, 332, 501, 669, 878
TfiI	GAWTC	2 cut(s)	512, 993
Tru1I	TTAA	1 cut(s)	164
Tru9I	TTAA	1 cut(s)	164
TscAI	CASTG	3 cut(s)	268, 906, 1123
TseFI	GTSAC	1 cut(s)	460
TseI	GCWGC	1 cut(s)	1076
Tsp45I	GTSAC	1 cut(s)	460
TspDTI	ATGAA	9 cut(s)	90, 93, 120, 217, 236, 349, 775, 805, 1125
TspGWI	ACGGA	2 cut(s)	626, 844
TspRI	CASTG	3 cut(s)	268, 906, 1123
Van91I	CCANNNNNTGG	1 cut(s)	665
XapI	RAATTY	1 cut(s)	878
XceI	RCATGY	1 cut(s)	313
XmiI	GTMKAC	1 cut(s)	937
XspI	CTAG	1 cut(s)	618

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.